Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012344735

STS probe D1S1423

Synopsis

Field NameValues
NameD1S1423
AliasesD1S1515
TypeSTS
Application
Source organism
Source sequence

Sequences

>Probe|12344735|PRIMERF Forward PCR primer (outermost) (19b)
TCACTGCAACCTCTGCCTC
>Probe|12344735|PRIMERR Reverse PCR primer (outermost) (20b)
TGTAGTCCCAGCTACTCGGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:330271
UniSTS IDcontext specific help for: UniSTS ID149619
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk