Display Settings:

Format

Send to:

Choose Destination
Pr012344410

STS probe D12S836 for ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B) and 2 more genes

Synopsis

Field NameValues
NameD12S836
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANKS1B; ANKS1B; ANKS1B
UniSTS IDUniSTS:149326

Sequences

>Probe|12344410|PRIMERF Forward PCR primer (outermost) (20b)
TATGAGCTAATGCCTTACAG
>Probe|12344410|PRIMERR Reverse PCR primer (outermost) (20b)
TTGGTAGGGACAGAATTTAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S836

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149326
Probe Cross-refcontext specific help for: Probe Cross-refGDB:315461
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk