Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012344227

Homo sapiens STS probe D22S528

Synopsis

Field NameValues
NameD22S528
AliasesUT5072; stD22S528
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12344227|PRIMERF Forward PCR primer (outermost) (19b)
AGCCCAGGAGTTCTCTGTC
>Probe|12344227|PRIMERR Reverse PCR primer (outermost) (20b)
TCTCATCTCACACACCATGC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S528
Homo sapienslinkageMarshfield2228.57 cmUT5072

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149161
Probe Cross-refcontext specific help for: Probe Cross-refGDB:313212
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk