Display Settings:

Format

Send to:

Choose Destination
Pr012343707

STS probe D14S308 for putative V-set and immunoglobulin domain-containing-like protein IGHV4OR15-8 (LOC100459421)

Synopsis

Field NameValues
NameD14S308
TypeSTS
Application
Source organism
Source sequence
Target geneLOC100459421
UniSTS IDUniSTS:148682

Sequences

>Probe|12343707|PRIMERF Forward PCR primer (outermost) (22b)
GGCGTTTCTGATGTTTTTAAGC
>Probe|12343707|PRIMERR Reverse PCR primer (outermost) (20b)
GAGACGATGGAGGAGTGAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:229255
UniSTS IDcontext specific help for: UniSTS ID148682
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk