Display Settings:

Format

Send to:

Choose Destination
Pr031783335

STS probe UniSTS:146574 for golgi-associated, gamma adaptin ear containing, ARF binding protein 3 (GGA3) and 5 more genes

Synopsis

Field NameValues
NameUniSTS:146574
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGGA3; NUP85; GGA3; NUP85; GGA3; GGA3
UniSTS IDUniSTS:146574

Sequences

>Probe|31783335|PRIMERF Forward PCR primer (outermost) (20b)
GTCTGGTGACTCAGCTCAAG
>Probe|31783335|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGGCATGAAATAAACTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmUniSTS:146574

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID146574
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk