Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012376694

Pongo abelii and Homo sapiens STS probe D22S585 for immunoglobulin lambda locus (IGL) and 3 more genes

Synopsis

Field NameValues
NameD22S585
AliasesAC22-265; D22S720; PB941; RH83594; RH95486; SHGC-7823; WI-265
TypeSTS
Application
Source organism
Source sequence
Target organismsPongo abelii; Homo sapiens
Target genesLOC100441415 (Pongo abelii); BMP6P1 (Homo sapiens); IGLV6-57 (Homo sapiens); IGL (Homo sapiens)

Sequences

>Probe|12376694|PRIMERF Forward PCR primer (outermost) (22b)
AGCTTTGTGGTGATTTTATTTC
>Probe|12376694|PRIMERR Reverse PCR primer (outermost) (20b)
TTTTCTGAGCTTTGGAAAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322254 cr10000SHGC-7823
Homo sapienslinkageRutgers Map22 cmD22S585
Homo sapiensradiation hybridNCBI RH2274.4 crSHGC-7823

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14348
Probe Cross-refcontext specific help for: Probe Cross-refGDB:335953
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...
Write to the Help Desk