Display Settings:

Format

Send to:

Choose Destination
Pr012376373

STS probe Gdf5 for growth differentiation factor 5 (Gdf5) and 1 more gene

Synopsis

Field NameValues
NameGdf5
AliasUniSTS:143190
TypeSTS
Application
Source organism
Source sequence
Target genesGdf5; Gdf5
UniSTS IDUniSTS:143190

Sequences

>Probe|12376373|PRIMERF Forward PCR primer (outermost) (19b)
GTCGTGGAATCTTGTGGCT
>Probe|12376373|PRIMERR Reverse PCR primer (outermost) (22b)
AGCCATGAAGATTCAGCTTTTA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk