Display Settings:

Format

Send to:

Choose Destination
Pr012374358

STS probe Col1a1 for collagen, type I, alpha 2 (COL1A2)

Synopsis

Field NameValues
NameCol1a1
AliasesCola1
TypeSTS
Application
Source organism
Source sequence
Target geneCOL1A2
UniSTS IDUniSTS:141374

Sequences

>Probe|12374358|PRIMERF Forward PCR primer (outermost) (20b)
AGCCCGGTAGTAGCGGCCAC
>Probe|12374358|PRIMERR Reverse PCR primer (outermost) (20b)
GCAAGTGGTGAACGTGGTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:8574
UniSTS IDcontext specific help for: UniSTS ID141374
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk