Display Settings:

Format

Send to:

Choose Destination
Pr012374060

STS probe UniSTS:141104 for adenomatous polyposis coli (APC) and 9 more genes

Synopsis

Field NameValues
NameUniSTS:141104
AliasesApc
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100048863; APC; LOC100431482; APC; Apc; Apc; Apc; APC; APC; APC
UniSTS IDUniSTS:141104

Sequences

>Probe|12374060|PRIMERF Forward PCR primer (outermost) (21b)
TCAGCCATGCCAACAAAGTCA
>Probe|12374060|PRIMERR Reverse PCR primer (outermost) (25b)
GGAAAAGTTTATAGGTGTCCCTTCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmUniSTS:141104

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID141104
Probe Cross-refcontext specific help for: Probe Cross-refMGI:8589
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk