Display Settings:

Format

Send to:

Choose Destination
Pr012373744

Homo sapiens STS probe D1S2662

Synopsis

Field NameValues
NameD1S2662
AliasesA204ZH1; AFMa204zh1; HSA204ZH1; RH30713; RH49294; SHGC-19963; W5679; stSG14361
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:14082

Sequences

>Probe|12373744|PRIMERF Forward PCR primer (outermost) (20b)
AGCTGGTTGTTCTATGCAGA
>Probe|12373744|PRIMERR Reverse PCR primer (outermost) (17b)
AACTGGTGCTTGCCGTA

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G318719 cr10000AFMa204zh1
Homo sapienslinkageRutgers Map1 cmD1S2662
Homo sapienslinkageMarshfield1242.34 cmAFMa204zh1
Homo sapienslinkagedeCODE1228.29 cmD1S2662
Homo sapienslinkageGenethon1246.2 cmAFMa204zh1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14082
Probe Cross-refcontext specific help for: Probe Cross-refGDB:606915
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk