Display Settings:

Format

Send to:

Choose Destination
Pr012372024

STS probe G62303 for glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B) and 1 more gene

Synopsis

Field NameValues
NameG62303
AliasesB22G23/SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGRIN2B; GRIN2B
UniSTS IDUniSTS:139270

Sequences

>Probe|12372024|PRIMERF Forward PCR primer (outermost) (21b)
GAAGCCCCTTATTCACATCTG
>Probe|12372024|PRIMERR Reverse PCR primer (outermost) (21b)
ACAACCCGAGGCAGTTATCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmG62303

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID139270
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk