Display Settings:

Format

Send to:

Choose Destination
Pr012370868

STS probe D18S63 for TGFB-induced factor homeobox 1 (TGIF1)

Synopsis

Field NameValues
NameD18S63
Aliases205TD6; AFM205TD6; AFM205td6; HS205TD6; RH34293; SHGC-5352
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneTGIF1
UniSTS IDUniSTS:13823

Sequences

>Probe|12370868|PRIMERF Forward PCR primer (outermost) (20b)
AGCTCATGTTGGATGTATCA
>Probe|12370868|PRIMERR Reverse PCR primer (outermost) (17b)
GTCAGACTACGCGCCTT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G318128 cr10000SHGC-5352
Homo sapiensradiation hybridGeneMap99-G318128 cr10000AFM205td6
Homo sapienslinkageRutgers Map18 cmD18S63
Homo sapienslinkageMarshfield188.3 cmAFM205td6
Homo sapienslinkagedeCODE189.57 cmD18S63
Homo sapienslinkageGenethon187.9 cmAFM205td6

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13823
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188316
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk