Display Settings:

Format

Send to:

Choose Destination
Pr012370101

STS probe D19S422 for actinin, alpha 4 (ACTN4) and 1 more gene

Synopsis

Field NameValues
NameD19S422
AliasesAFMA123XE9; AFMa123xe9; HSA123XE9
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesACTN4; ACTN4
UniSTS IDUniSTS:13754

Sequences

>Probe|12370101|PRIMERF Forward PCR primer (outermost) (21b)
AGCTATGATCTCACCACTGTA
>Probe|12370101|PRIMERR Reverse PCR primer (outermost) (18b)
CAGCATTTTGCCAGACTT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map19 cmD19S422
Homo sapienslinkageMarshfield1963.1 cmAFMa123xe9
Homo sapienslinkagedeCODE1964.12 cmD19S422
Homo sapienslinkageGenethon1962.5 cmAFMa123xe9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13754
Probe Cross-refcontext specific help for: Probe Cross-refGDB:200106
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk