Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012368619

Homo sapiens and Nomascus leucogenys STS probe RH123995 for SHC (Src homology 2 domain containing) transforming protein 3 (SHC3) and 1 more gene

Synopsis

Field NameValues
NameRH123995
AliasesSHGC-106222
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Homo sapiens
Target genesSHC3 (Nomascus leucogenys); SHC3 (Homo sapiens)

Sequences

>Probe|12368619|PRIMERF Forward PCR primer (outermost) (23b)
TCACTAGGGGTTTATCAAGAGCG
>Probe|12368619|PRIMERR Reverse PCR primer (outermost) (22b)
GAAATGTTGAGTCGGTGTCAGC

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG932348 cr50000SHGC-106222
Homo sapienslinkageRutgers Map9 cmRH123995

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID136205
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk