Display Settings:

Format

Send to:

Choose Destination
Pr012360059

STS probe G41299 for glutamate ionotropic receptor NMDA type subunit 2B (GRIN2B) and 2 more genes

Synopsis

Field NameValues
NameG41299
AliasB224C2/SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGRIN2B; GRIN2B; GRIN2B
UniSTS IDUniSTS:12850

Sequences

>Probe|12360059|PRIMERF Forward PCR primer (outermost) (20b)
AGCACCATAAATGCCCAATC
>Probe|12360059|PRIMERR Reverse PCR primer (outermost) (20b)
ACACTGCGTTCACATTCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmG41299

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12850
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk