Display Settings:

Format

Send to:

Choose Destination
Pr012359100

STS probe D15Mit264 for interleukin 7 receptor (Il7r)

Synopsis

Field NameValues
NameD15Mit264
AliasesMTH296
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneIl7r
UniSTS IDUniSTS:127637

Sequences

>Probe|12359100|PRIMERF Forward PCR primer (outermost) (21b)
AAACAAACAGACAGACCCAGC
>Probe|12359100|PRIMERR Reverse PCR primer (outermost) (22b)
CTGTACACATGTGCATCTGTGC

References

1.

A genetic map of the mouse with 4,006 simple sequence length polymorphisms.

Dietrich WF, Miller JC, Steen RG, Merchant M, Damron D, Nahf R, Gross A, Joyce DC, Wessel M, Dredge RD, et al.

Nat Genet. 1994 Jun;7(2 Spec No):220-45.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculuslinkageWI_GEN155.5 cmD15Mit264

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:705087
UniSTS IDcontext specific help for: UniSTS ID127637
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk