Display Settings:

Format

Send to:

Choose Destination
Pr012358995

STS probe D15Mit17 for myelocytomatosis oncogene (Myc) and 1 more gene

Synopsis

Field NameValues
NameD15Mit17
AliasesD22
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesMyc; Myc
UniSTS IDUniSTS:127542

Sequences

>Probe|12358995|PRIMERF Forward PCR primer (outermost) (20b)
GCGTCACTGATAGTAGGGAG
>Probe|12358995|PRIMERR Reverse PCR primer (outermost) (20b)
GTACCCCAATCCTGAACCAC

References

1.

A genetic map of the mouse with 4,006 simple sequence length polymorphisms.

Dietrich WF, Miller JC, Steen RG, Merchant M, Damron D, Nahf R, Gross A, Joyce DC, Wessel M, Dredge RD, et al.

Nat Genet. 1994 Jun;7(2 Spec No):220-45.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculuslinkageWI_GEN1526.2 cmD15Mit17

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk