Display Settings:

Format

Send to:

Choose Destination
Pr012356016

Mus musculus STS probe K01347 for similar to glial fibrillary acidic protein (LOC631521)

Synopsis

Field NameValues
NameK01347
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneLOC631521 (Mus musculus)
UniSTS IDUniSTS:124860

Sequences

>Probe|12356016|PRIMERF Forward PCR primer (outermost) (20b)
CCTTCCTTCCCTGGTTTTCT
>Probe|12356016|PRIMERR Reverse PCR primer (outermost) (20b)
TGCTCATCTTTCCTCTTCCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID124860
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk