Display Settings:

Format

Send to:

Choose Destination
Pr012355571

STS probe SHGC-60616 for sorting nexin 29 (SNX29) and 4 more genes

Synopsis

Field NameValues
NameSHGC-60616
AliasesIB779; RH82781
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNPIPB5; LOC653761; LOC654191; SNX29; SNX29
UniSTS IDUniSTS:12446

Sequences

>Probe|12355571|PRIMERF Forward PCR primer (outermost) (20b)
AGATGAACTTTCTTGGCACA
>Probe|12355571|PRIMERR Reverse PCR primer (outermost) (20b)
GGTTTCAGCCCTAAAGGTAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmSHGC-60616

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12446
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk