Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012354949

Eukaryota (5 taxa) STS probe D14S1236 for A kinase (PRKA) anchor protein 6 (AKAP6) and 4 more genes

Synopsis

Field NameValues
NameD14S1236
AliasesMR12214; WI-9732
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Homo sapiens; Sus scrofa; Bos taurus
Target genesAKAP6 (Sus scrofa); AKAP6 (Nomascus leucogenys); AKAP6 (Bos taurus); AKAP6 (Macaca mulatta); AKAP6 (Homo sapiens)

Sequences

>Probe|12354949|PRIMERF Forward PCR primer (outermost) (24b)
AGATCACTAATTTTCCTTTTCCCC
>Probe|12354949|PRIMERR Reverse PCR primer (outermost) (24b)
AAATTATGTTGGTTTGAAAGGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD14S1236

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12390
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678428
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk