Display Settings:

Format

Send to:

Choose Destination
Pr012351813

STS probe A006X30 for protein kinase D2 (PRKD2) and 5 more genes

Synopsis

Field NameValues
NameA006X30
AliasesRH26133
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRKD2; LOC100446924; PRKD2; PRKD2; PRKD2; PRKD2
UniSTS IDUniSTS:12019

Sequences

>Probe|12351813|PRIMERF Forward PCR primer (outermost) (20b)
AGAGATGAGTCCGTTTTAAT
>Probe|12351813|PRIMERR Reverse PCR primer (outermost) (18b)
GCAATGAACTGTTCTAGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419255.98 cr3000A006X30
Homo sapienslinkageRutgers Map19 cmA006X30
Homo sapiensradiation hybridNCBI RH19516.7 crA006X30

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12019
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk