Display Settings:

Format

Send to:

Choose Destination
Pr012351520

STS probe SHGC-14361 for myosin IIIB (MYO3B) and 1 more gene

Synopsis

Field NameValues
NameSHGC-14361
AliasesRH29714
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMYO3B; MYO3B
UniSTS IDUniSTS:1199

Sequences

>Probe|12351520|PRIMERF Forward PCR primer (outermost) (24b)
AAAGAACATTGGAAGTACTGGAGG
>Probe|12351520|PRIMERR Reverse PCR primer (outermost) (20b)
CTCCAGCTCCAAGAGTTTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G326896 cr10000SHGC-14361
Homo sapienslinkageRutgers Map2 cmSHGC-14361
Homo sapiensradiation hybridNCBI RH21334.6 crSHGC-14361

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID1199
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk