Display Settings:

Format

Send to:

Choose Destination
Pr012350792

Mus musculus and Rattus norvegicus STS probe D7Wox15 for myelocytomatosis oncogene (Myc) and 1 more gene

Synopsis

Field NameValues
NameD7Wox15
AliasesD15Kyo1; Myc; RH87746
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus
Target genesMyc (Mus musculus); Myc (Rattus norvegicus)
UniSTS IDUniSTS:119242

Sequences

>Probe|12350792|PRIMERF Forward PCR primer (outermost) (19b)
CTAGTCCGACCAGCGTCAC
>Probe|12350792|PRIMERR Reverse PCR primer (outermost) (20b)
GTACCCCAATCCTGAACCAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:7; RGD:10937
UniSTS IDcontext specific help for: UniSTS ID119242
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk