Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012348344

Eukaryota (5 taxa) STS probe G32453 for RNA binding motif protein 17 (RBM17) and 4 more genes

Synopsis

Field NameValues
NameG32453
AliasesA009D35
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesRBM17 (Pongo abelii); RBM17 (Nomascus leucogenys); RBM17 (Pan troglodytes); RBM17 (Macaca mulatta); RBM17 (Homo sapiens)

Sequences

>Probe|12348344|PRIMERF Forward PCR primer (outermost) (23b)
CAACCTGAATAAGATTGAAGAAT
>Probe|12348344|PRIMERR Reverse PCR primer (outermost) (23b)
CATTTCTGATCTACCCTTAAGAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmG32453

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID117039
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk