Display Settings:

Format

Send to:

Choose Destination
Pr012338236

Eukaryota (5 taxa) STS probe G54015 for eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa (EIF2B2) and 4 more genes

Synopsis

Field NameValues
NameG54015
Aliases1746
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesEIF2B2 (Callithrix jacchus); EIF2B2 (Pongo abelii); EIF2B2 (Nomascus leucogenys); EIF2B2 (Pan troglodytes); EIF2B2 (Homo sapiens)
UniSTS IDUniSTS:109397

Sequences

>Probe|12338236|PRIMERF Forward PCR primer (outermost) (20b)
CAGACGCAACCAGGTCACTA
>Probe|12338236|PRIMERR Reverse PCR primer (outermost) (20b)
TAGTCACCCCGTAACAAGGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmG54015

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID109397
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk