Display Settings:

Format

Send to:

Choose Destination
Pr012337970

STS probe G49410 for phospholipase A2 group VI (PLA2G6) and 3 more genes

Synopsis

Field NameValues
NameG49410
AliasstbK228A9_82189
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPLA2G6; PLA2G6; PLA2G6; PLA2G6
UniSTS IDUniSTS:109155

Sequences

>Probe|12337970|PRIMERF Forward PCR primer (outermost) (18b)
TGGAGGTCTGCCCACACT
>Probe|12337970|PRIMERR Reverse PCR primer (outermost) (20b)
ACAAGGAACCTGAGGCAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmG49410

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID109155
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk