Display Settings:

Format

Send to:

Choose Destination
Pr012337812

Eukaryota (3 taxa) STS probe G49256 for phospholipase A2, group VI (cytosolic, calcium-independent) (PLA2G6) and 2 more genes

Synopsis

Field NameValues
NameG49256
AliasesstbK228A9_89490
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesPLA2G6 (Nomascus leucogenys); PLA2G6 (Pan troglodytes); PLA2G6 (Homo sapiens)
UniSTS IDUniSTS:109012

Sequences

>Probe|12337812|PRIMERF Forward PCR primer (outermost) (20b)
TGAAGCAGATCAGAACACGG
>Probe|12337812|PRIMERR Reverse PCR primer (outermost) (21b)
GTCCTTCAGGGAATTCGTAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmG49256

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID109012
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk