Display Settings:

Format

Send to:

Choose Destination
Pr012337236

STS probe SHGC-36487 for chemokine-like factor (CKLF) and 6 more genes

Synopsis

Field NameValues
NameSHGC-36487
AliasesRH37867; RH83169
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCKLF; LOC100460097; LOC100596628; CKLF; CMTM1; LOC454145; CKLF
UniSTS IDUniSTS:10847

Sequences

>Probe|12337236|PRIMERF Forward PCR primer (outermost) (23b)
ACTTCTTTTTTTTCATGCACAGG
>Probe|12337236|PRIMERR Reverse PCR primer (outermost) (20b)
GCCCTTATTTACCGGAAGCT

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G3162853 cr10000SHGC-36487
Homo sapiensradiation hybridTNG1628639 cr50000SHGC-36487
Homo sapienslinkageRutgers Map16 cmSHGC-36487

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID10847
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk