Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012332923

Pan troglodytes and Homo sapiens STS probe SHGC-84099 for FRAS1 related extracellular matrix 1 (FREM1) and 1 more gene

Synopsis

Field NameValues
NameSHGC-84099
AliasesRH113650
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesFREM1 (Homo sapiens); FREM1 (Pan troglodytes)

Sequences

>Probe|12332923|PRIMERF Forward PCR primer (outermost) (23b)
CAGGGAATTAAGGGGTAATCAGG
>Probe|12332923|PRIMERR Reverse PCR primer (outermost) (23b)
ATCCAACACGCTCACTCTAAAGC

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG96825 cr50000SHGC-84099
Homo sapienslinkageRutgers Map9 cmSHGC-84099

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID104563
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk