Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012332543

Eukaryota (4 taxa) STS probe SHGC-82273 for F-box and WD repeat domain containing 11 (FBXW11) and 3 more genes

Synopsis

Field NameValues
NameSHGC-82273
AliasesRH113301
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Macaca mulatta; Pan troglodytes; Homo sapiens
Target genesFBXW11 (Callithrix jacchus); FBXW11 (Homo sapiens); FBXW11 (Pan troglodytes); FBXW11 (Macaca mulatta)

Sequences

>Probe|12332543|PRIMERF Forward PCR primer (outermost) (23b)
TAACCATGTCAGCATCTGGGTAA
>Probe|12332543|PRIMERR Reverse PCR primer (outermost) (23b)
GGCTTTGAACAGTGGAAAAGAGA

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG580498 cr50000SHGC-82273
Homo sapienslinkageRutgers Map5 cmSHGC-82273

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID104220
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk