Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012331557

Homo sapiens STS probe SHGC-81108 for tau tubulin kinase 2 (TTBK2) and 1 more gene

Synopsis

Field NameValues
NameSHGC-81108
AliasesRH112398
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100505791 (Homo sapiens); TTBK2 (Homo sapiens)

Sequences

>Probe|12331557|PRIMERF Forward PCR primer (outermost) (22b)
GAGAGCACTATGGCAATGTTGG
>Probe|12331557|PRIMERR Reverse PCR primer (outermost) (23b)
CATGCCTCCAGCTATGAAACAAT

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG15578 cr50000SHGC-81108
Homo sapienslinkageRutgers Map15 cmSHGC-81108

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID103332
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk