Display Settings:

Format

Send to:

Choose Destination
Pr012328538

Eukaryota (6 taxa) STS probe RH106538 for SIX homeobox 1 (SIX1) and 5 more genes

Synopsis

Field NameValues
NameRH106538
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesSIX1 (Callithrix jacchus); SIX1 (Pongo abelii); SIX1 (Nomascus leucogenys); SIX1 (Pan troglodytes); SIX1 (Homo sapiens); SIX1 (Macaca mulatta)
UniSTS IDUniSTS:100611

Sequences

>Probe|12328538|PRIMERF Forward PCR primer (outermost) (20b)
GGTCCTAAGTGGGGAGGGAC
>Probe|12328538|PRIMERR Reverse PCR primer (outermost) (24b)
TTGGGAAGGAAAATGCAAAAGTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmRH106538

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID100611
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk