Display Settings:

Format
Items per page

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information

Results: 9

1.

Homo sapiens primer set probe Exon TCTGCCTGGAAAGCCAGGTG for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288284
ID:
12288284
Name:
Exon TCTGCCTGGAAAGCCAGGTG
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
2.

Homo sapiens primer set probe Exon TCAGTGCTCCATGATGACAC for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288283
ID:
12288283
Name:
Exon TCAGTGCTCCATGATGACAC
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
3.

Homo sapiens primer set probe Exon GCGAGTGGTTTTGAAACAGG for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288282
ID:
12288282
Name:
Exon GCGAGTGGTTTTGAAACAGG
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
4.

Homo sapiens primer set probe Exon GCCTCTGTCCTTGCCAGAAG for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288281
ID:
12288281
Name:
Exon GCCTCTGTCCTTGCCAGAAG
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
5.

Homo sapiens primer set probe Exon GCCCGACTGCCTTGTACCAT for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288280
ID:
12288280
Name:
Exon GCCCGACTGCCTTGTACCAT
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
6.

Homo sapiens primer set probe Exon CGGGCTACCTCGGAGCCGAT for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288279
ID:
12288279
Name:
Exon CGGGCTACCTCGGAGCCGAT
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
7.

Homo sapiens primer set probe Exon CGCTCACACAGAGAAGTCTT for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288278
ID:
12288278
Name:
Exon CGCTCACACAGAGAAGTCTT
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
8.

Homo sapiens primer set probe Exon AGAGATGCCCTGGCCAGGAA for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288277
ID:
12288277
Name:
Exon AGAGATGCCCTGGCCAGGAA
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1
9.

Homo sapiens primer set probe Exon AACTAAGGCGGAATCAGCAC for SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1)

Accession:
Pr012288276
ID:
12288276
Name:
Exon AACTAAGGCGGAATCAGCAC
Type:
primer set
Application:
variation analysis
Source organism:
Homo sapiens
Source gene:
SMARCB1
Target organism:
Homo sapiens
Target gene:
SMARCB1

Display Settings:

Format
Items per page

Send to:

Choose Destination

Supplemental Content

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk