Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr010050111

Medicago truncatula primer set probe AC158498_10.1 for chromosome 2 BAC clone mth2-65n13 (AC158498)

Synopsis

Field NameValues
NameAC158498_10.1
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Target organismMedicago truncatula
Target sequenceAC158498 (Medicago truncatula)

Sequences

>Probe|10050111|PRIMERF Forward PCR primer (outermost) (20b)
GGGAATGAAGAGCACAGGAG
>Probe|10050111|PRIMERR Reverse PCR primer (outermost) (20b)
GTCGATCACGAGGACCTTTC

References

1.

A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula.

Kakar K, Wandrey M, Czechowski T, Gaertner T, Scheible WR, Stitt M, Torres-Jerez I, Xiao Y, Redman JC, Wu HC, Cheung F, Town CD, Udvardi MK.

Plant Methods. 2008 Jul 8;4:18. doi: 10.1186/1746-4811-4-18.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Methodology filecontext specific help for: Methodology file Primer design [PMID: 18611268] (797 bytes)
Resultcontext specific help for: ResultAmplicon size (bp): 119
Amplification result: specific amplification

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk