Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr140400

Homo sapiens shRNA probe V2HS_84106 for damage-specific DNA binding protein 2, 48kDa (DDB2)

Synopsis

Field NameValues
NameV2HS_84106
TypeshRNA
Applicationgene silencing
Other applicationsRNAi
Source organismHomo sapiens
Source sequenceNM_000107 (Homo sapiens)
Source geneDDB2 (Homo sapiens)
Target organismHomo sapiens
Target sequenceNM_000107 (Homo sapiens)
Target geneDDB2 (Homo sapiens)

Sequences

>Probe|140400|SHRNA_SEQUENCE shRNA sequence (97b)
TGCTGTTGACAGTGAGCGAGATTCTTACCGGATATTACAATAGTGAAGCCACAGATGTATTGTAATATCCGGTAAGAATCCTGCCTACTGCCTCGGA
PositionFeature
1..18mir 30 context
19..40sense
41..59mir 30 loop
60..81antisense
82..97mir 30 context

References

1.

Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

Cleary MA, Kilian K, Wang Y, Bradshaw J, Cavet G, Ge W, Kulkarni A, Paddison PJ, Chang K, Sheth N, Leproust E, Coffey EM, Burchard J, McCombie WR, Linsley P, Hannon GJ.

Nat Methods. 2004 Dec;1(3):241-8. Epub 2004 Nov 18.

2.

A resource for large-scale RNA-interference-based screens in mammals.

Paddison PJ, Silva JM, Conklin DS, Schlabach M, Li M, Aruleba S, Balija V, O'Shaughnessy A, Gnoj L, Scobie K, Chang K, Westbrook T, Cleary M, Sachidanandam R, McCombie WR, Elledge SJ, Hannon GJ.

Nature. 2004 Mar 25;428(6981):427-31.

Computational maps for probe

Analysis is pending.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk