Display Settings:

Format

Send to:

Choose Destination
Pr032222795

Saccharomyces cerevisiae primer set probe ARS317

Synopsis

Field NameValues
NameARS317
Typeprimer set
Applicationgene expression
Source organismSaccharomyces cerevisiae
Source sequence
Target organismSaccharomyces cerevisiae

Sequences

>Probe|32222795|PRIMERF Forward PCR primer (outermost) OJL3090 (33b)
CAGTGTTTTCAATTTTTTATTAAACAATGTTTG
>Probe|32222795|PRIMERR Reverse PCR primer (outermost) OJL3091 (33b)
AATTAAATAAAACGTTTCTACTTTTTTTCAAGG

References

1.

Regulatory mechanisms that prevent re-initiation of DNA replication can be locally modulated at origins by nearby sequence elements.

Richardson CD, Li JJ.

PLoS Genet. 2014 Jun 19;10(6):e1004358. doi: 10.1371/journal.pgen.1004358. eCollection 2014 Jun.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk