Display Settings:

Format

Send to:

Choose Destination
Pr032065034

Homo sapiens primer set probe SCAP for SREBF chaperone (SCAP)

Synopsis

Field NameValues
NameSCAP
Typeprimer set
Applicationgene expression
Source organismHomo sapiens
Source sequence
Source geneSCAP (Homo sapiens)
Target organismHomo sapiens
Target geneSCAP (Homo sapiens)

Sequences

>Probe|32065034|PRIMERF Forward PCR primer (outermost) (20b)
ACGCTGTACAAGGTGGCGGC
>Probe|32065034|PRIMERR Reverse PCR primer (outermost) (20b)
CGGGTGGCGCATAGCCGTAG

References

1.

Regulation of Gγ-globin gene by ATF2 and its associated proteins through the cAMP-response element.

Liu L, Karmakar S, Dhar R, Mahajan M, Choudhury A, Weissman S, Pace BS.

PLoS One. 2013 Nov 6;8(11):e78253. doi: 10.1371/journal.pone.0078253. eCollection 2013.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk