Display Settings:

Format

Send to:

Choose Destination
Pr031905018

primer set probe SEC31B for SEC31 homolog B, COPII coat complex component (SEC31B)

Synopsis

Field NameValues
NameSEC31B
Typeprimer set
Applicationgenotyping
Source organism
Source sequence
Source geneSEC31B
Target geneSEC31B

Sequences

>Probe|31905018|PRIMERF Forward PCR primer (outermost) SEC31B_F_DNA (20b)
TTGGATCCGGCTCTACTGTC
>Probe|31905018|PRIMERR Reverse PCR primer (outermost) SEC31B_R_DNA (20b)
CAGCATCAAGAGCCCGTATT

References

1.

Deep bisulfite sequencing of aberrantly methylated loci in a patient with multiple methylation defects.

Beygo J, Ammerpohl O, Gritzan D, Heitmann M, Rademacher K, Richter J, Caliebe A, Siebert R, Horsthemke B, Buiting K.

PLoS One. 2013 Oct 9;8(10):e76953. doi: 10.1371/journal.pone.0076953. eCollection 2013. PLoS One. 2013;8(12). doi:10.1371/annotation/8a05c514-48b6-4dd9-b322-273b575cbd95.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size481
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center