Display Settings:

Format

Send to:

Choose Destination
Pr031894781

primer set probe Exon 20 for epidermal growth factor receptor (EGFR)

Synopsis

Field NameValues
NameExon 20
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneEGFR
Target geneEGFR

Sequences

>Probe|31894781|PRIMERF Forward PCR primer (outermost) (20b)
CGCATTCATGCGTCTTCACC
>Probe|31894781|PRIMERR Reverse PCR primer (outermost) (20b)
CTATCCCAGGAGCGCAGACC

References

1.

A subset of gastric cancers with EGFR amplification and overexpression respond to cetuximab therapy.

Zhang L, Yang J, Cai J, Song X, Deng J, Huang X, Chen D, Yang M, Wery JP, Li S, Wu A, Li Z, Li Z, Liu Y, Chen Y, Li Q, Ji J.

Sci Rep. 2013 Oct 21;3:2992. doi: 10.1038/srep02992.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk