Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr031780777

Homo sapiens primer set probe COX-2 for prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2)

Synopsis

Field NameValues
NameCOX-2
Typeprimer set
Applicationgene expression
Source organismHomo sapiens
Source sequence
Source genePTGS2 (Homo sapiens)
Target organismHomo sapiens
Target genePTGS2 (Homo sapiens)

Sequences

>Probe|31780777|PRIMERF Forward PCR primer (outermost) (23b)
TTCAAATGAGATTGTGGGAAAAT
>Probe|31780777|PRIMERR Reverse PCR primer (outermost) (24b)
AGATCATCTCTGCCTGAGTATCTT

References

1.

Investigation of radiation-induced transcriptome profile of radioresistant non-small cell lung cancer A549 cells using RNA-seq.

Yang HJ, Kim N, Seong KM, Youn H, Youn B.

PLoS One. 2013;8(3):e59319. doi: 10.1371/journal.pone.0059319. Epub 2013 Mar 22.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size305
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk