Display Settings:

Format

Send to:

Choose Destination
Pr017054787

shRNA probe TRCN0000314689 for JMJD7-PLA2G4B readthrough (JMJD7-PLA2G4B)

Synopsis

Field NameValues
NameTRCN0000314689
TypeshRNA
Applicationgene silencing
Source organism
Source sequence
Target organismsMus musculus; Homo sapiens
Target sequenceNM_005090 (Homo sapiens)
Target geneJMJD7-PLA2G4B

Sequences

>Probe|17054787|FULL_SEQUENCE Full sequence of the hairpin (58b)
CCGGGTTGCAGGTGGGAACTGTCATCTCGAGATGACAGTTCCCACCTGCAACTTTTTG
PositionFeature
5..25sense sequence [rna]
32..52antisense sequence [rna]

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk