Display Settings:

Format

Send to:

Choose Destination
Pr017049666

shRNA probe TRCN0000298971 for leukotriene A4 hydrolase (LTA4H)

Synopsis

Field NameValues
NameTRCN0000298971
TypeshRNA
Applicationgene silencing
Source organism
Source sequence
Target organismsMus musculus; Homo sapiens
Target sequenceNM_000895 (Homo sapiens)
Target geneLTA4H

Sequences

>Probe|17049666|FULL_SEQUENCE Full sequence of the hairpin (58b)
CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
PositionFeature
5..25sense sequence [rna]
32..52antisense sequence [rna]

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk