![]() | ![]() |
Formats:
|
||||||||||||||||||||||||||||||
Copyright © 2004, American Society for Microbiology Nucleolar Localization of Human Hepatitis B Virus Capsid Protein† Department of Pathology and Department of Microbiology & Immunology, WHO Collaborating Center for Tropical Diseases and Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, Texas *Corresponding author. Mailing address: Department of Pathology and Department of Microbiology & Immunology, WHO Collaborating Center for Tropical Diseases and Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0609. Phone: (409) 772-2563. Fax: (409) 747-2429. E-mail: cshih/at/utmb.edu. Received May 25, 2004; Accepted August 12, 2004. This article has been corrected. See J Virol. 2005 April; 79(7): 4552. This article has been cited by other articles in PMC.Abstract Wild-type human hepatitis B virus (HBV) exhibits selective export of virions containing mature genomes. In contrast, changing an isoleucine to a leucine at amino acid 97 (I97L) of the HBV core antigen (HBcAg) causes it to release immature genomes. To elucidate the structure-function relationship of HBcAg at amino acid 97, we systematically replaced the isoleucine residue at this position with 18 other amino acids via mutagenesis. Twelve of the 18 mutants exhibited no significant phenotype, while five new mutants displayed strong phenotypes. The I97D mutant had a near lethal phenotype, the I97P mutant exhibited a significantly reduced level of virion secretion, and the I97G mutant lacked the full-length relaxed circular form of viral DNA. The tip of the spike of the capsid particle is known to contain a predominant B-cell epitope. However, the recognition of this exposed epitope by an anti-HBc antibody appeared to be affected by the I97E mutation or by histidine tagging at the C terminus of mutant HBcAg, which is presumably in the capsid interior. Surprisingly, the nuclear HBcAg of mutants I97E and I97W, produced from either a replicon or an expression vector, was found to be colocalized with nucleolin and B23 at a frequency of nearly 100% by confocal immunofluorescence microscopy. In contrast, this colocalization occurred with wild-type HBcAg only to a limited extent. We also noted that nucleolin-colocalizing cells were often binucleated or apoptotic, suggesting that the presence of HBcAg in the nucleolus may perturb cytokinesis. The mechanism of this phenomenon and its potential involvement in liver pathogenesis are discussed. To our knowledge, this is the first report of nucleolar HBcAg in culture. Hepatitis B virus (HBV) is a major human infectious pathogen that was first discovered in leukemia patients and Australian aboriginals in 1965 (3). More than one-third of the world's population has been infected with HBV (77). Chronic active hepatitis associated with HBV infection often leads to the development of cirrhosis, liver failure, and highly malignant liver cancer (1, 2, 6, 23). In part because of the emergence of drug-resistant HBV variants, current treatments for hepatitis B have a disappointingly low efficacy compared to those for hepatitis C (9, 33). A new target, other than HBV polymerase, needs to be identified for therapeutic treatment. A better basic understanding of the life cycle of HBV, including the functional significance of HBV variants and the mechanism of virion secretion, might lead to new clinical interventions for chronic infections with HBV. The release of HBV virions from hepatocytes is a tightly regulated event. The current dogma indicates that the mature HBV genome is preferentially exported from the intracellular compartment (24, 48, 60, 65). Recently, members of our laboratory identified an immature secretion phenotype of a highly frequent naturally occurring HBV variant containing a leucine residue at amino acid 97 of the core protein. Unlike wild-type HBV, this 97L variant secretes almost equal amounts of mature and immature genomes (73, 74). This unexpected phenomenon is not caused by instability of the core particles or by any deficiency in viral reverse transcription (35, 44, 73, 74). In addition to the I97L immature secretion variant, other naturally occurring and artificially created capsid mutants exhibit a so-called low secretion phenotype with significantly reduced virion secretion while maintaining normal intracellular viral DNA replication (12, 30, 34, 49). The mechanisms for both immature secretion and low secretion phenomena remain to be elucidated. The expression of the HBV core antigen (HBcAg) has been studied with mammalian cell systems (42, 47, 53). HBcAg was found to be localized to the cytoplasm (47) in COS cells and predominantly to the nucleus in mouse 3T3 fibroblasts (42). HBcAg was found to be distributed in both the nucleus and the cytoplasm in HBV-producing hepatocytes and transgenic mice (11, 25, 61, 62). It has also been documented that in HBeAg-positive patients, a nucleus-dominant distribution of intrahepatic HBcAg is associated with minor hepatitis activity while a cytoplasmic distribution of HBcAg is associated with chronic active liver disease (12). The molecular basis for the shift from nuclear distribution and minor disease activity to cytoplasmic distribution and disease exacerbation has been unclear. Frequent mutations have been found to accumulate in HBcAg during natural infections with HBV (13, 21, 26, 28, 57). It is tempting to hypothesize that naturally occurring HBcAg variants contribute to the change in the subcellular localization of HBcAg. To further investigate the mechanism of HBV virion secretion and HBcAg subcellular localization in HBcAg variants, we systematically introduced different amino acids at position 97 of HBcAg and analyzed their phenotypic consequences via several different functional assays. In addition to using virus replication and virion secretion assays, we examined the potential relationship between nuclear targeting and virion secretion by immunofluorescence microscopy. Although we detected no significant phenotypic changes for 12 of 18 mutants, we observed strong phenotypes for 6 mutants. Most intriguingly, the I97E mutant appeared to have an increased accumulation of nuclear HBcAg. Furthermore, the nuclear HBcAg of mutants I97E and I97W usually colocalized with nucleolin. In summary, like the delta antigen of hepatitis D virus (5, 31, 40, 63), the HBcAgs of both wild-type and mutant HBV can localize to the nucleolus, albeit at a lower frequency and to a limited extent for wild-type HBV. The mechanism of this unexpected nucleolar localization of HBcAg and its potential biological significance in non-immunity-mediated liver injury during natural infection are discussed (10, 18, 43). MATERIALS AND METHODS Plasmid constructs. (i) HBV core protein expression vectors. Plasmids pSVC-I97I (carries wild-type adr), pSVC-I97A, pSVC-I97C, pSVC-I97D, pSVC-I97E, pSVC-I97G, pSVC-I97H, pSVC-I97K, pSVC-I97M, pSVC-I97N, pSVC-I97P, pSVC-I97Q, pSVC-I97R, pSVC-I97S, pSVC-I97T, pSVC-I97V, pSVC-I97W, and pSVC-I97Y are wild-type and mutant core antigen expression vectors with a simian virus 40 early enhancer and promoter. These vectors were constructed via site-directed mutagenesis by PCR amplification of the core gene from wild-type pSVC-I97I (68) (Table 1). All mutants were confirmed by DNA sequencing. Plasmids pSVC-I97L and pSVC-I97F were described previously (74).
(ii) Histidine tagging of HBcAg I97D, I97E, I97G, and I97P. For the construction of pSVC His-tag derivatives, two primers were designed to amplify core gene fragments containing six consecutive histidine residues at the C terminus of HBcAg. The upstream primer (5′-AGA AAG CTT AGC TGT GCC TTG GGT GGC TTT-3′) contained HBV plus-strand DNA sequences from nucleotides (nt) 1877 to 1897 with a HindIII cleavage site (underlined). The downstream primer (54-mer, 5′-AGA GAG CTC CTA GTG GTG GTG GTG GTG GTG ACA TTG AGA TTC CCG AGA TTG AGA-3′) contained six consecutive histidine sequences (in italics) and a SacI cleavage site (underlined). Ten nanograms of each pSVC DNA and a 0.5 μM concentration of each primer were used in 50-μl PCRs consisting of a 94°C denaturing step (40 s) followed by 25 cycles of amplification at 94°C (15 s), 60°C (15 s), and 72°C (40 s). After digestion with HindIII and SacI, the amplified and restriction-digested target sequences were inserted into the HindIII and SacI cloning sites of a pSV2 vector. (iii) Replicon plasmids Wt EKO and I97W EKO. When a wild-type tandem dimer replicon is used for transfection, both HBcAg and HBeAg will be produced. Because HBcAg and HBeAg are closely related immunologically, most polyclonal antibodies cannot distinguish between them. We engineered plasmid EKO to knock out HBeAg production by site-directed mutagenesis. To create a TAA stop codon downstream of the HBeAg initiation codon, we used a 3.2-kb HBV monomer (adr) in a pBluescript plasmid as a template and PCR amplified a monomer fragment by using a pair of complementary primers (sense primer, 5′ TTCACCAGCACCATGTAACTTTTTCACCTC 3′). The amplified mutant monomer genome was cut with BamHI and dimerized in tandem in pBluescript. Wt EKO and mutant I97W EKO of HBV adr origin were confirmed by DNA sequencing. They were replication competent and secreted little HBeAg in the medium, as measured by an enzyme-linked immunosorbent assay (low signals were detected due to released naked core particles [data not shown]). Mutant 1903. Mutant 1903 bears an ablated AUG initiation codon of HBcAg in both copies of the ayw HBV tandem dimer. This mutant is thus replication defective due to the absence of core protein production (73). Mutant 1903 can be rescued to replicate if the core protein is provided by trans-complementation. Immunoblot analysis of core and His-tag fusion proteins. Ten micrograms of wild-type or mutant core expression vector DNA was transfected into human Huh7 hepatoma cells. The cell lysates were harvested at 3 days posttransfection, and core protein expression was detected by Western blot analysis using a diluted (1:500) rabbit anti-HBcAg antibody (Dako Cytomation Co., Carpinteria, Calif.). The detection of His-tag fusion proteins was performed by use of a His-tag monoclonal antibody at a working concentration of 0.2 μg/ml (Novagen Co., Madison, Wis.). Immunofluorescence assay for core protein. Huh7 hepatoma cells were seeded on coverslips placed in 35-mm-diameter tissue culture dishes 1 day before transfection. Three microliters of FuGene 6 (Roche Co., Indianapolis, Ind.) or GeneJuice (Novagen Co.) and 1 μg of plasmid DNA were used to transfect subconfluent cells as instructed by the manufacturers. At 3 or 5 days posttransfection, monolayer cultures on coverslips were washed with phosphate-buffered saline (PBS) twice before fixation. For acetone-methanol (1:1) fixation, the coverslips were drained and then fixed in ice-cold acetone-methanol for 5 min. Alternatively, cells were fixed with freshly prepared 4% paraformaldehyde in PBS for 10 min, washed twice with PBS, permeabilized with 0.2% Triton X-100 in PBS for 5 min at room temperature, and finally washed again four times with PBS. HBcAg was stained with either diluted (1:500) rabbit anti-HBcAg antibody (Dako Co.) or a mouse monoclonal antibody (Hyb-3120; Institute of Immunology, Tokyo, Japan). The Hyb-3120 mouse monoclonal antibody recognizes a capsid conformation-specific epitope (15). Goat anti-rabbit-fluorescein isothiocyanate (FITC) and goat anti-mouse immunoglobulin G (IgG)-tetramethylrhodamine isocyanate (TRITC) or rabbit anti-goat-TRITC and goat anti-mouse IgG-FITC were used as secondary antibodies for the experiments shown in Fig. Fig.55
Transfection, viral replication, and virion secretion assays. For DNA transfection, 10 μg of pSVC and 10 μg of mutant 1903 plasmid DNAs were adjusted to a final total of 35 μg with carrier DNA and then transfected into the Huh7 human hepatoma cell line by the calcium phosphate coprecipitation method (56). The preparation of intracellular core particles and viral DNA and gradient centrifugation analyses of secreted viral particles were performed as detailed elsewhere (73). Annexin V and TUNEL assays for apoptosis. To investigate the potential correlation between the expression of HBcAg and host cell apoptosis, we used annexin V-FITC staining to detect early-stage apoptosis (Annexin V-FITC apoptosis detection kit; Sigma) and a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) assay to detect late-stage apoptosis (ApoAlert DNA Fragmentation assay kit; BD Biosciences, Palo Alto, Calif.) according to the instructions provided by the manufacturers. Topological view of residue Ile97 and its neighbors. The data for the crystal structure of the HBV capsid monomer were retrieved from the web site http://www.rcsb.org/pdb (accession number 1QGT). The data were visualized and analyzed with the Insight II and Swiss-PdbViewer, version 3.7b2, programs retrieved from http://www.expasy.ch/spdbv/mainpage.html. RESULTS A total of 18 different HBcAg mutants containing different substitutions at amino acid 97 were analyzed for their capabilities of DNA replication, virion secretion, and HBcAg nuclear accumulation. Briefly, Huh7 cells were cotransfected with mutant 1903 (core-deficient) and different HBcAg-expressing plasmids containing various mutations at amino acid 97. Assays for DNA replication and virion secretion were performed at 5 days posttransfection, while the nuclear accumulation of HBcAg was visualized at approximately 3 to 5 days posttransfection. Significant replication defect of mutants I97G and I97D. As shown in Fig. Fig.1,1
Virion release deficiency of I97 mutants. In addition to the replication assay, we performed assays of virion release into the medium. As shown in Fig. Fig.2,2 Were the mutant phenotypes caused by an alteration of epitope recognition or by protein instability? To determine if any of the aforementioned phenotypes were caused by alterations in mutant protein stability, we performed an immunoblot analysis to determine the steady-state level of HBcAg. As shown in Fig. Fig.3a,3a
HBcAg of wild-type HBV and those of mutants I97E and I97W are targeted for the nucleolus at different frequencies. In our studies of naturally occurring secretion variants, we speculated that a low secretion behavior might be caused by an increased efficiency of nuclear targeting and, conversely, that an immature secretion variant might cause a decreased efficiency of nuclear targeting. In other words, we wished to test whether nuclear targeting and endoplasmic reticulum budding are two competing pathways for the same pool of capsid particles. Furthermore, we wanted to ask whether HBcAg variants are responsible for the shift from a cytoplasm-dominant to a nucleus-dominant distribution of HBcAg. To these ends, we performed immunofluorescence microscopy of Huh7 cells that were transiently transfected with wild-type or mutant plasmids in the context of either an expression vector or a replicon. The immunostaining patterns of HBcAgs from most mutants (Table 1; data not shown) and from the wild type (Fig. (Fig.5)5 This nucleolar localization phenomenon was observed even at a lower dose of input DNA for transfection (0.25 μg of DNA per 35-mm-diameter dish) (data not shown). This was observed with either a rabbit anti-core polyclonal antibody or a capsid conformation-specific mouse monoclonal antibody (Hyb-3120) (data not shown). Finally, this phenomenon was also observed in the context of either an expression vector (pSVC) or a replicon (EKO), indicating that no other viral components are required for HBcAg to colocalize with nucleolin (Fig. (Fig.6).6
It is also worth mentioning that in most cases, we used the acetone-methanol method for fixation (see Materials and Methods) (Fig. (Fig.55
The nucleolin-colocalizing phenotype of HBcAg was not necessarily associated with the phenotype of nucleus-dominant staining. We also observed very strong nucleolin colocalization in some cells with a cytoplasm-dominant staining pattern (data not shown). HBcAg of the I97E mutant does not colocalize with splicing factor SC35. Previously, it was reported that the duck hepatitis B virus (DHBV) core protein can be localized to the periphery of a spliceosome compartment (39). As shown in Fig. Fig.8,8 Apoptosis. We noted that a substantial fraction of the nucleolus- and HBcAg-colocalizing cells seemed to be apoptotic, adjacent to an apoptotic-like nucleus, or binucleated (Fig. (Fig.9a).9a DISCUSSION Interestingly, as summarized in Fig. Fig.10,10
Hydrophobic neighborhood around amino acid 97. According to the known structure of the T=4 capsid of HBcAg 1-149, amino acid 97 of the HBV core protein is located on the α4b helix (4, 14, 66) and is near the kink at amino acids 90 to 92 (Fig. (Fig.11).11
Alteration of epitope recognition and its implication in genome maturation signal hypothesis. A dominant B-cell epitope of HBcAg has been mapped to the tip of the spike of the capsid particle (54, 66). Since the tip of the spike is spatially distal to both the C terminus and position 97 of HBcAg, we did not anticipate that the recognition of this epitope in the I97E mutant and of His-tagged HBcAg by an anti-core polyclonal antibody would be dramatically reduced or totally lost, as shown by immunoblot analysis (Fig. (Fig.4).4 Colocalization of nucleolin and HBcAg of mutants I97E and I97W. Cytoplasmic nucleocapsids of hepadnaviruses can deliver the viral genome to the nucleus and thus amplify the pool of intranuclear covalently closed circular DNA (64). The DHBV core protein has been found to be distributed in the nucleus as distinct nuclear bodies (38, 39). Using indirect immunofluorescence, Mabit et al. (39) demonstrated that the DHBV core protein is highly concentrated in the so-called nuclear core bodies, which are always localized at the periphery of the spliceosome compartment of infected duck hepatocytes. The functional significance of this phenomenon remains unclear. In our study, we also found brightly staining nuclear core body-like spots in the nuclei of Huh7 cells that were transfected with either the I97E or I97W mutant, and on less frequent occasions, with wild-type HBV. However, there was no convincing evidence to exclude the occasional colocalization of SC35 and some of the HBcAg of a wild-type or mutant HBV (Fig. (Fig.8).8 The capsid proteins of the I97E and I97W mutants that accumulated in the nucleolus were not monomers or dimers of HBcAg since they could be immunostained with a monoclonal antibody (Hyb-3120) specific for the HBV capsid conformation (data not shown) (15). At present, it remains unclear whether these nucleolus-associated capsids are imported through the nuclear pore complex from the cytoplasm without prior disassembly or are reassembled from imported capsid protein monomers and dimers. On some rare occasions, we found some small nuclear foci of HBcAg that did not appear to colocalize with nucleolin. However, examinations of further sections by confocal microscopy often revealed that these foci also colocalized with nucleolin (data not shown). We speculate here that these small HBcAg foci probably occurred when the new capsids just passed through the nuclear pore or when all of the existing nucleoli had already been saturated with HBcAg. Several viral proteins have been localized to the nucleolus, including the coronavirus nucleoprotein (8), the UL3 protein of herpes simplex virus type 2 (69), the E7 protein of human papillomavirus type 16 (76), the delta antigen of hepatitis D virus (31, 63), and the Rev and Tat proteins of human immunodeficiency virus (HIV) (19, 36). The Rev protein is well known for its role in nuclear RNA export (17, 22, 27). Since we did not detect colocalization of HBcAg and nucleolin in every HBcAg-positive cell that was transfected with the wild-type replicon EKO, a more sensitive method for detecting colocalization will be needed to address this issue. Mechanism of nucleolin and HBcAg colocalization. The highly frequent colocalization of mutant HBcAg with nucleolin may be caused by several possibilities, including (i) an increased import of mutant capsids from the cytoplasm to the nucleus, (ii) increased trafficking or binding of mutant HBcAg from the nucleoplasm to the nucleolus, (iii) an increased tendency of forming mutant protein aggregates in the nucleolus, (iv) an increased induction of apoptosis, which in turn somehow contributes to colocalization, and (v) combinations of the above. The fourth possibility can be excluded because we found no difference in the rates of apoptosis, as measured by annexin V and TUNEL assays, between wild-type and mutant HBcAg-transfected cultures (data not shown). We noted that a significant fraction of colocalizing cells were binucleated or apoptotic. It is quite possible that when wild-type or mutant HBcAg is expressed at a high level, it is cytotoxic to host hepatocytes (45, 52, 72; P. Chua and C. Shih, unpublished results). This may be another mechanism for non-immunity-mediated liver injury during natural infection (18). It is known that the nucleolus can sequester cell cycle regulatory molecules, including p53 (46). Furthermore, telomerase RNP is partly assembled in the nucleolus. Recently, nucleolin has been reported to bind to the AU-rich element of bcl-2 mRNA. The downregulation of nucleolin leads to the destabilization of bcl-2 mRNA and induces apoptosis (55). The N protein of coronavirus is also known to localize to the nucleolus, and multinucleated cells are common in coronavirus-infected cultures (8). Taken together, these data suggest that apoptosis is the effect, rather than the cause, of the colocalization phenomenon. At present, we cannot exclude the third possibility, that the HBcAgs of mutants I97E and I97W, when expressed at high levels, tend to aggregate in the nucleolus. However, it is worth mentioning that the steady-state levels of the HBcAgs of mutants I97E and I97W were lower than or similar to that of the wild type (Fig. (Fig.33 We currently entertain the first two possibilities of increased nuclear or nucleolar trafficking and increased binding of mutant HBcAg to the nucleolus. Previously, a nucleolar localization sequence of the type I human T-cell leukemia virus pX protein was identified (58). This sequence motif is very rich in arginine and proline and contains serine and/or threonine (Fig. 12a
However, the different extents of nucleolar colocalization between wild-type HBcAg and those of the I97E and I97W mutants still cannot be explained by their having the same sequences of the arginine-rich domains of HBcAg. It is possible that the I97E and I97W mutant capsids tend to expose their arginine-rich domains more easily than wild-type capsids. When we compared the sequences in the vicinity of amino acid 97 of HBcAg with the sequences in the vicinity of a conserved nucleolin binding site of the hepatitis delta antigen (32) as well as the nuclear localization sequences of adenovirus protein V (41) and simian virus 40 (SV40) TAg (67), we saw only a limited degree of homology (Fig. 12b In summary, of all the possibilities, we are in favor of the first two possibilities of increased nuclear targeting and/or import as well as increased trafficking to or physical association with the nucleolus. These possibilities should be experimentally testable in the near future. Our studies indicate that amino acid 97 of HBcAg is at a very sensitive and critical position for the structure and function of HBV capsid particles. [Supplemental material]
Acknowledgments This work was funded by NIH grants R01 CA 70336 and CA 84217 to C.S. We thank colleagues in C. Shih's laboratory for careful reading of the manuscript. We also thank Ning-Hsing Yeh and S. C. Lee for the anti-nucleolin antibody, Eugene Knutson and Tom Albrecht at the Optical Imaging Center of UTMB for their help with confocal laser scanning microscopy, Istvan Boldogh for advice on apoptosis assays, and Ming-Jing Huang for help with structural analysis using the INSIGHT II computer program. Footnotes †Supplemental material for this article may be found at http://jvi.asm.org/. REFERENCES 1. Beasley, R. P., L. Y. Hwang, C. C. Lin, and C. S. Chien. 1981. Hepatocellular carcinoma and hepatitis B virus. A prospective study of 22,707 men in Taiwan. Lancet ii:1129-1133. 2. Block, T. M., A. S. Mehta, C. J. Fimmel, and R. Jordan. 2003. Molecular viral oncology of hepatocellular carcinoma. Oncogene 22:5093-5107. [PubMed] 3. Blumberg, B. S., H. J. Alter, and S. Visnich. 1965. A “new” antigen in leukemia sera. JAMA 191:541-546. [PubMed] 4. Bottcher, B., S. A. Wynne, and R. A. Crowther. 1997. Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy. Nature 386:88-91. [PubMed] 5. Chang, M. F., S. C. Baker, L. H. Soe, T. Kamahora, J. G. Keck, S. Makino, S. Govindarajan, and M. M. Lai. 1988. Human hepatitis delta antigen is a nuclear phosphoprotein with RNA-binding activity. J. Virol. 62:2403-2410. [PubMed] 6. Chang, M. H., C. J. Chen, M. S. Lai, H. M. Hsu, T. C. Wu, M. S. Kong, D. C. Liang, W. Y. Shau, and D. S. Chen. 1997. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. Taiwan Childhood Hepatoma Study Group. N. Engl. J. Med. 336:1906-1907. [PubMed] 7. Chen, C. M., S. Y. Chiang, and N. H. Yeh. 1991. Increased stability of nucleolin in proliferating cells by inhibition of self cleaving activity. J. Biol. Chem. 266:7754-7758. [PubMed] 8. Chen, H., T. Wurm, P. Britton, G. Brooks, and J. A. Hiscox. 2002. Interaction of the coronavirus nucleoprotein with nucleolar antigens and the host cells. J. Virol. 76:5233-5250. [PubMed] 9. Chen, R. Y., P. V. Desmond, and S. A. Locarnini. 2002. Emerging therapies of hepatitis B and C. J. Gastroenterol. Hepatol. 2002(Suppl.):S471-S481. 10. Chisari, F. V., and C. Ferrari. 1995. Hepatitis B virus immunopathogenesis. Annu. Rev. Immunol. 13:29-60. [PubMed] 11. Chu, C. M., and Y. F. Liaw. 1987. Intrahepatic distribution of hepatitis B surface and core antigens in chronic hepatitis B virus infection. Gastroenterology 92:220-225. [PubMed] 12. Chua, P. K., Y. M. Wen, and C. Shih. 2003. Coexistence of two distinct secretion mutations (P5T and I97L) in hepatitis B virus core produces a wild-type pattern of secretion. J. Virol. 77:7673-7676. [PubMed] 13. Chuang, W. L., M. Omata, T. Ehata, O. Yokosuka, Y. Ito, F. Imwki, S. N. Lu, W. Y. Chang, and M. Ohto. 1993. Precore mutations and core clustering mutations in chronic hepatitis B virus infection. Gastroenterology 104:263-271. [PubMed] 14. Conway, J. F., N. Cheng, A. Zlotnick, P. T. Wingfield, S. J. Stahl, and A. C. Steven. 1997. Visualization of a 4-helix bundle in the hepatitis B virus capsid by cryo-electron microscopy. Nature 386:91-94. [PubMed] 15. Conway, J. F., N. R. Watts, D. M. Belnap, N. Cheng, S. J. Stahl, P. T. Wingfield, and A. C. Steven. 2003. Characterization of a conformational epitope on hepatitis B virus core antigen and quasiequivalent variations in antibody binding. J. Virol. 77:6466-6473. [PubMed] 16. Crowther, R. A., N. A. Kiselev, B. Bottcher, J. A. Berriman, G. P. Borisova, V. Ose, and P. Pumpens. 1994. Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy. Cell 77:943-950. [PubMed] 17. Cullen, B. R. 1998. Retroviruses as model systems for the study of nuclear RNA export pathways. Virology 249:203-210. [PubMed] 18. Dienstag, J. L. 1984. Immunologic mechanisms in chronic viral hepatitis, p. 167-177. In G. N. Vyas, J. L. Dienstag, and J. H. Hoofnagle (ed.), Viral hepatitis and liver diseases. Grune & Stratton, New York, N.Y. 19. Dundr, M., G. H. Leno, M. L. Hammarskjold, D. Rekosh, C. Helga-Maria, and M. O. Olson. 1995. The roles of nucleolar structure and function in the subcellular location of the HIV-1 Rev protein. J. Cell Sci. 108:2811-2823. [PubMed] 20. Eckhardt, S. G., D. R. Milich, and A. McLachlan. 1991. Hepatitis B virus core antigen has two nuclear localization sequences in the arginine-rich carboxyl terminus. J. Virol. 65:575-582. [PubMed] 21. Ehata, T., M. Omata, O. Yolosuka, K. Hosoda, and M. Ohto. 1992. Variations in codons 84-101 in the core nucleotide sequence correlate with hepatocellular injury in chronic hepatitis B virus infection. J. Clin. Investig. 89:332-338. [PubMed] 22. Fischer, U., J. Huber, W. C. Boelens, I. W. Mattaj, and R. Luhrmann. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 82:475-483. [PubMed] 23. Ganem, D., and R. Schneider. 2001. Hepadnaviridae: the viruses and their replication, p. 2923-2970. In D. M. Knipe et al. (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa. 24. Gerelsaikhan, T., J. E. Tavis, and V. Bruss. 1996. Hepatitis B virus nucleocapsid envelopment does not occur without genomic DNA synthesis. J. Virol. 70:4269-4274. [PubMed] 25. Guidotti, L. G., B. Matzke, H. Schaller, and F. V. Chisari. 1995. High-level hepatitis B virus replication in transgenic mice. J. Virol. 69:6158-6169. [PubMed] 26. Gunther, S., L. Fischer, I. Pult, M. Sterneck, N. Piwon, and H. Will. 1999. Naturally occurring variants of hepatitis B virus. Adv. Virus Res. 52:25-137. [PubMed] 27. Hope, T. J. 1999. The ins and outs of HIV Rev. Arch. Biochem. Biophys. 365:186-191. [PubMed] 28. Hosono, S., P. C. Tai, W. Wang, M. Ambrose, D. Hwang, T. T. Yuan, B. H. Peng, C. S. Yang, C. S. Lee, and C. Shih. 1995. Core antigen mutations of human hepatitis B virus in hepatomas accumulate in MHC class II-restricted T cell epitopes. Virology 212:151-162. [PubMed] 29. Kann, M., B. Sodeik, A. Vlachou, W. H. Gerlich, and A. Helenius. 1999. Phosphorylation-dependent binding of hepatitis B virus core particles to the nuclear pore complex. J. Cell Biol. 145:45-55. [PubMed] 30. Koschel, M., D. Oed, T. Gerelsaikhan, R. Thomssen, and V. Bruss. 2000. Hepatitis B virus core gene mutations which block nucleocapsid envelopment. J. Virol. 74:1-7. [PubMed] 31. Lai, M. M. C. 1995. The molecular biology of hepatitis delta virus. Annu. Rev. Biochem. 64:259-286. [PubMed] 32. Lee, C. H., S. C. Chang, C. J. Chen, and M. F. Chang. 1998. The nucleolin binding activity of hepatitis delta antigen is associated with nucleolus targeting. J. Biol. Chem. 273:7650-7656. [PubMed] 33. Lemon, S. M. 1999. Current status of antiviral therapy for chronic hepatitis C. Adv. Exp. Med. Biol. 458:29-37. [PubMed] 34. Le Pogam, S., T. T. Yuan, G. K. Sahu, S. Chatterjee, and C. Shih. 2000. Low-level secretion of human hepatitis B virus virions caused by two independent, naturally occurring mutations (P5T and L60V) in the capsid protein. J. Virol. 74:9099-9105. [PubMed] 35. Le Pogam, S., and C. Shih. 2002. Influence of a putative intermolecular interaction between core and the pre-S1 domain of the large envelope protein on hepatitis B virus secretion. J. Virol. 76:6510-6517. [PubMed] 36. Li, Y. P. 1997. Protein B23 is an important human factor for the nucleolar localization of the human immunodeficiency virus protein Tat. J. Virol. 71:4098-4102. [PubMed] 37. Liu, J. L., L. F. Lee, Y. Ye, Z. Qian, and H. J. Kung. 1997. Nucleolar and nuclear localization properties of a herpesvirus bZIP oncoprotein, MEQ. J. Virol. 71:3188-3196. [PubMed] 38. Mabit, H., K. M. Breiner, A. Knaust, B. Zachmann-Brand, and H. Schaller. 2001. Signals for bidirectional nucleocytoplasmic transport in the duck hepatitis B virus capsid protein. J. Virol. 75:1968-1977. [PubMed] 39. Mabit, H., A. Knaust, K. M. Breiner, and H. Schaller. 2003. Nuclear localization of the duck hepatitis B virus capsid protein: detection and functional implications of distinct subnuclear bodies in a compartment associated with RNA synthesis and maturation. J. Virol. 77:2157-2164. [PubMed] 40. Macnaughton, T. B., E. J. Gowans, A. R. Jilbert, and C. J. Burrell. 1990. Hepatitis delta virus RNA, protein synthesis and associated cytotoxicity in a stably transfected cell line. Virology 177:692-698. [PubMed] 41. Matthews, D. A. 2001. Adenovirus protein V induces redistribution of nucleolin and B23 from nucleolus to cytoplasm. J. Virol. 75:1031-1038. [PubMed] 42. McLachlan, A., D. R. Milich, A. K. Raney, M. G. Riggs, J. L. Hughes, J. Sorge, and F. V. Chisari. 1987. Expression of hepatitis B virus surface and core antigens: influences of pre-S and precore sequences. J. Virol. 61:683-692. [PubMed] 43. Milich, D. R. 1997. Immune response to the hepatitis B virus: infection, animal models, and vaccination. Viral Hepat. 3:63-103. 44. Newman, M., F. M. Suk, M. Cajimat, P. K. Chua, and C. Shih. 2003. Stability and morphology comparisons of self-assembled virus-like particles from wild-type and mutant human hepatitis B virus capsid proteins. J. Virol. 77:12950-12960. [PubMed] 45. Ohori, H., and K. Matsuda. 1989. Intra- and extracellular distribution and immunochemical characterization of hepatitis B virus nucleocapsid proteins produced by a human hepatoma cell line transfected with cloned viral DNA. Virology 168:40-47. [PubMed] 46. Olson, M. O. J., M. Dundr, and A. Szebeni. 2000. The nucleolus: an old factory with unexpected capabilities. Trends Cell Biol. 10:189-196. [PubMed] 47. Ou, J. H., O. Laub, and W. J. Rutter. 1986. Hepatitis B virus gene function: the precore region targets the core antigen to cellular membranes and causes the secretion of the e antigen. Proc. Natl. Acad. Sci. USA 83:1578-1582. [PubMed] 48. Perlman, D., and J. Hu. 2003. Duck hepatitis B virus virion secretion requires a double-stranded DNA genome. J. Virol. 77:2287-2294. [PubMed] 49. Ponsel, D., and V. Bruss. 2003. Mapping of amino acid side chains on the surface of hepatitis B virus capsids required for envelopment and virion formation. J. Virol. 77:416-422. [PubMed] 50. Pugh, J., A. Zweidler, and J. Summers. 1989. Characterization of the major duck hepatitis B virus core particle protein. J. Virol. 63:1371-1376. [PubMed] 51. Rabe, B., A. Vlachou, N. Pante, A. Helenius, and M. Kann. 2003. Nuclear import of hepatitis B virus capsids and release of the viral genome. Proc. Natl. Acad. Sci. USA 100:9849-9854. [PubMed] 52. Roingeard, P., J. L. Romet-Lemonne, D. Leturcq, A. Goudeau, and M. Essex. 1990. Hepatitis B virus core antigen (HBc Ag) accumulation in an HBV nonproducer clone of HepG2-transfected cells is associated with cytopathic effect. Virology 179:113-120. [PubMed] 53. Roossinck, M. J., S. Jameel, S. H. Loukin, and A. Siddiqui. 1986. Expression of hepatitis B viral core region in mammalian cells. Mol. Cell. Biol. 6:1393-1400. [PubMed] 54. Salfeld, J., E. Pfaff, M. Noah, and H. Schaller. 1989. Antigenic determinants and functional domains in core antigen and e antigen from hepatitis B virus. J. Virol. 63:798-808. [PubMed] 55. Sengupta, T. K., S. Bandyopadhyay, D. J. Fernandes, and E. K. Spicer. 2004. Identification of nucleolin as an AU-rich element binding protein involved in bcl-2 mRNA stabilization. J. Biol. Chem. 279:10855-10863. [PubMed] 56. Shih, C., L. S. Li, S. Roychoudhury, and M. H. Ho. 1989. In vitro propagation of human hepatitis B virus in a rat hepatoma cell line. Proc. Natl. Acad. Sci. USA 86:6323-6327. [PubMed] 57. Shih, C. 2003. Functional significance of naturally occurring hepatitis B virus variants, p. 23-41. In S. Locarnini and C. L. Lai (ed.), Human virus guides—human hepatitis B viruses. International Medical Press (IMP), London, United Kingdom. 58. Siomi, H., H. Shida, S. H. Nam, T. Nosaka, M. Maki, and M. Hatanaka. 1988. Sequence requirements for nucleolar localization of human T cell leukemia virus type I pX protein, which regulates viral RNA processing. Cell 55:197-209. [PubMed] 59. Suk, F. M., M. H. Lin, M. Newman, S. Pan, S. H. Chen, J. D. Liu, and C. Shih. 2002. Replication advantage and host factor-independent phenotypes attributable to a common naturally occurring capsid mutation (I97L) in human hepatitis B virus. J. Virol. 76:12069-12077. [PubMed] 60. Summers, J., and W. S. Mason. 1982. Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 29:403-415. [PubMed] 61. Sureau, C., J. L. Romet-Lemonne, J. I. Mullins, and M. Essex. 1986. Production of hepatitis B virus by a differentiated human hepatoma cell line after transfection with cloned circular HBV DNA. Cell 47:37-47. [PubMed] 62. Tai, P. C., F. M. Suk, W. H. Gerlich, A. R. Neurath, and C. Shih. 2002. Hypermodification and immune escape of an internally deleted middle-envelope (M) protein of frequent and predominant hepatitis B virus variants. Virology 292:44-58. [PubMed] 63. Taylor, J. M. 2003. Replication of human hepatitis delta virus: recent developments. Trends Microbiol. 11:185-190. [PubMed] 64. Tuttleman, J. S., C. Pourcel, and J. Summers. 1986. Formation of the pool of covalently closed circular viral DNA in hepadnavirus-infected cells. Cell 47:451-460. [PubMed] 65. Wei, Y., J. E. Tavis, and D. Ganem. 1996. Relationship between viral DNA synthesis and virion envelopment in hepatitis B viruses. J. Virol. 70:6455-6458. [PubMed] 66. Wynne, S. A., R. A. Crowther, and A. G. Leslie. 1999. The crystal structure of the human hepatitis B virus capsid. Mol. Cell 3:771-780. [PubMed] 67. Xue, Z., X. Shan, B. Lapeyre, and T. Melese. 1993. The amino terminus of mammalian nucleolin specifically recognizes SV40 T-antigen type nuclear localization sequences. Eur. J. Cell Biol. 62:13-21. [PubMed] 68. Yaginuma, K., Y. Shirakata, M. Kobayashi, and K. Koike. 1987. Hepatitis B virus (HBV) particles are produced in a cell culture system by transient expression of transfected HBV DNA. Proc. Natl. Acad. Sci. USA 84:2678-2682. [PubMed] 69. Yamada, H., Y. M. Jiang, H. Y. Zhu, K. Inagaki-Ohara, and Y. Nishiyama. 1999. Nucleolar localization of the UL3 protein of herpes simplex virus type 2. J. Gen. Virol. 80:2157-2164. [PubMed] 70. Yeh, C. T., Y. F. Liaw, and J. H. Ou. 1990. The arginine-rich domain of hepatitis B virus precore and core proteins contains a signal for nuclear transport. J. Virol. 64:6141-6147. [PubMed] 71. Yeh, C. T., S. W. Wong, Y. K. Fung, and J. H. Ou. 1993. Cell cycle regulation of nuclear localization of hepatitis B virus core protein. Proc. Natl. Acad. Sci. USA 90:6459-6463. [PubMed] 72. Yoakum, G. H., B. E. Korba, J. F. Lechner, T. Tokiwa, A. F. Gazdar, T. Seeley, M. Siegel, L. Leeman, H. Autrup, and C. D. Harris. 1983. High-frequency transfection and cytopathology of the hepatitis B virus core antigen gene in human cells. Science 222:385-389. [PubMed] 73. Yuan, T. T., G. K. Sahu, W. E. Whitehead, R. Greenberg, and C. Shih. 1999. The mechanism of an immature secretion phenotype of a highly frequent naturally occurring missense mutation at codon 97 of human hepatitis B virus core antigen. J. Virol. 73:5731-5740. [PubMed] 74. Yuan, T. T., P. C. Tai, and C. Shih. 1999. Subtype-independent immature secretion and subtype-dependent replication deficiency of a highly frequent, naturally occurring mutation of human hepatitis B virus core antigen. J. Virol. 73:10122-10128. [PubMed] 75. Yuan, T. T., and C. Shih. 2000. A frequent, naturally occurring mutation (P130T) of human hepatitis B virus core antigen is compensatory for immature secretion phenotype of another frequent variant (I97L). J. Virol. 74:4929-4932. [PubMed] 76. Zatsepina, O., J. Braspenning, D. Robberson, M. A. Hajibagheri, K. J. Blight, S. Ely, M. Hibma, D. Spitkovsky, M. Trendelenburg, L. Crawford, and M. Tommasino. 1997. The human papillomavirus type 16 E7 protein is associated with the nucleolus in mammalian and yeast cells. Oncogene 14:1137-1145. [PubMed] 77. Zuckerman, A. J. 1999. More than third of world's population has been infected with hepatitis B virus. Br. Med. J. 318:1213. |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||||||||
JAMA. 1965 Feb 15; 191():541-6.
[JAMA. 1965]Oncogene. 2003 Aug 11; 22(33):5093-107.
[Oncogene. 2003]N Engl J Med. 1997 Jun 26; 336(26):1906-7.
[N Engl J Med. 1997]Adv Exp Med Biol. 1999; 458():29-37.
[Adv Exp Med Biol. 1999]J Virol. 1996 Jul; 70(7):4269-74.
[J Virol. 1996]J Virol. 2003 Feb; 77(3):2287-94.
[J Virol. 2003]Cell. 1982 Jun; 29(2):403-15.
[Cell. 1982]J Virol. 1996 Sep; 70(9):6455-8.
[J Virol. 1996]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 1987 Mar; 61(3):683-92.
[J Virol. 1987]Proc Natl Acad Sci U S A. 1986 Mar; 83(6):1578-82.
[Proc Natl Acad Sci U S A. 1986]Mol Cell Biol. 1986 May; 6(5):1393-400.
[Mol Cell Biol. 1986]Gastroenterology. 1987 Jan; 92(1):220-5.
[Gastroenterology. 1987]J Virol. 1995 Oct; 69(10):6158-69.
[J Virol. 1995]J Virol. 1988 Jul; 62(7):2403-10.
[J Virol. 1988]Annu Rev Biochem. 1995; 64():259-86.
[Annu Rev Biochem. 1995]Virology. 1990 Aug; 177(2):692-8.
[Virology. 1990]Trends Microbiol. 2003 Apr; 11(4):185-90.
[Trends Microbiol. 2003]Annu Rev Immunol. 1995; 13():29-60.
[Annu Rev Immunol. 1995]Proc Natl Acad Sci U S A. 1987 May; 84(9):2678-82.
[Proc Natl Acad Sci U S A. 1987]J Virol. 1999 Dec; 73(12):10122-8.
[J Virol. 1999]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 2003 Jun; 77(11):6466-73.
[J Virol. 2003]J Biol Chem. 1991 Apr 25; 266(12):7754-8.
[J Biol Chem. 1991]Proc Natl Acad Sci U S A. 1989 Aug; 86(16):6323-7.
[Proc Natl Acad Sci U S A. 1989]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 2003 Jul; 77(13):7673-6.
[J Virol. 2003]J Virol. 2000 Oct; 74(19):9099-105.
[J Virol. 2000]J Virol. 2002 Jul; 76(13):6510-7.
[J Virol. 2002]J Virol. 2002 Dec; 76(23):12069-77.
[J Virol. 2002]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 1989 Feb; 63(2):798-808.
[J Virol. 1989]Nature. 1997 Mar 6; 386(6620):88-91.
[Nature. 1997]Nature. 1997 Mar 6; 386(6620):91-4.
[Nature. 1997]Cell. 1994 Jun 17; 77(6):943-50.
[Cell. 1994]Mol Cell. 1999 Jun; 3(6):771-80.
[Mol Cell. 1999]Virology. 2002 Jan 5; 292(1):44-58.
[Virology. 2002]J Virol. 1990 Dec; 64(12):6141-7.
[J Virol. 1990]Proc Natl Acad Sci U S A. 1993 Jul 15; 90(14):6459-63.
[Proc Natl Acad Sci U S A. 1993]J Virol. 2003 Feb; 77(3):2157-64.
[J Virol. 2003]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 1999 Dec; 73(12):10122-8.
[J Virol. 1999]J Virol. 2000 Oct; 74(19):9099-105.
[J Virol. 2000]J Virol. 2003 Jan; 77(1):416-22.
[J Virol. 2003]Nature. 1997 Mar 6; 386(6620):88-91.
[Nature. 1997]Nature. 1997 Mar 6; 386(6620):91-4.
[Nature. 1997]Mol Cell. 1999 Jun; 3(6):771-80.
[Mol Cell. 1999]J Virol. 1989 Feb; 63(2):798-808.
[J Virol. 1989]Mol Cell. 1999 Jun; 3(6):771-80.
[Mol Cell. 1999]J Virol. 1989 Mar; 63(3):1371-6.
[J Virol. 1989]J Cell Biol. 1999 Apr 5; 145(1):45-55.
[J Cell Biol. 1999]Proc Natl Acad Sci U S A. 2003 Aug 19; 100(17):9849-54.
[Proc Natl Acad Sci U S A. 2003]Cell. 1986 Nov 7; 47(3):451-60.
[Cell. 1986]J Virol. 2001 Feb; 75(4):1968-77.
[J Virol. 2001]J Virol. 2003 Feb; 77(3):2157-64.
[J Virol. 2003]J Virol. 2003 Jun; 77(11):6466-73.
[J Virol. 2003]J Virol. 2002 May; 76(10):5233-50.
[J Virol. 2002]J Gen Virol. 1999 Aug; 80 ( Pt 8)():2157-64.
[J Gen Virol. 1999]Oncogene. 1997 Mar 13; 14(10):1137-45.
[Oncogene. 1997]Annu Rev Biochem. 1995; 64():259-86.
[Annu Rev Biochem. 1995]Trends Microbiol. 2003 Apr; 11(4):185-90.
[Trends Microbiol. 2003]Virology. 1989 Jan; 168(1):40-7.
[Virology. 1989]Virology. 1990 Nov; 179(1):113-20.
[Virology. 1990]Science. 1983 Oct 28; 222(4622):385-9.
[Science. 1983]Trends Cell Biol. 2000 May; 10(5):189-96.
[Trends Cell Biol. 2000]J Biol Chem. 2004 Mar 19; 279(12):10855-63.
[J Biol Chem. 2004]J Virol. 2002 May; 76(10):5233-50.
[J Virol. 2002]Cell. 1988 Oct 21; 55(2):197-209.
[Cell. 1988]J Virol. 1991 Feb; 65(2):575-82.
[J Virol. 1991]J Cell Biol. 1999 Apr 5; 145(1):45-55.
[J Cell Biol. 1999]J Virol. 1990 Dec; 64(12):6141-7.
[J Virol. 1990]Proc Natl Acad Sci U S A. 1993 Jul 15; 90(14):6459-63.
[Proc Natl Acad Sci U S A. 1993]J Biol Chem. 1998 Mar 27; 273(13):7650-6.
[J Biol Chem. 1998]J Virol. 2001 Jan; 75(2):1031-8.
[J Virol. 2001]Eur J Cell Biol. 1993 Oct; 62(1):13-21.
[Eur J Cell Biol. 1993]J Virol. 1999 Dec; 73(12):10122-8.
[J Virol. 1999]J Virol. 2003 Jul; 77(13):7673-6.
[J Virol. 2003]J Virol. 2002 Jul; 76(13):6510-7.
[J Virol. 2002]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]J Virol. 1999 Dec; 73(12):10122-8.
[J Virol. 1999]Proc Natl Acad Sci U S A. 1989 Aug; 86(16):6323-7.
[Proc Natl Acad Sci U S A. 1989]J Virol. 1999 Dec; 73(12):10122-8.
[J Virol. 1999]J Virol. 2003 Jul; 77(13):7673-6.
[J Virol. 2003]J Virol. 2000 Oct; 74(19):9099-105.
[J Virol. 2000]J Virol. 2002 Jul; 76(13):6510-7.
[J Virol. 2002]J Virol. 2002 Dec; 76(23):12069-77.
[J Virol. 2002]J Virol. 1999 Jul; 73(7):5731-40.
[J Virol. 1999]Cell. 1988 Oct 21; 55(2):197-209.
[Cell. 1988]J Biol Chem. 1998 Mar 27; 273(13):7650-6.
[J Biol Chem. 1998]J Virol. 2001 Jan; 75(2):1031-8.
[J Virol. 2001]Eur J Cell Biol. 1993 Oct; 62(1):13-21.
[Eur J Cell Biol. 1993]