• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of celstresspringer.comThis journalToc AlertsSubmit OnlineOpen ChoiceThis Journal
Cell Stress Chaperones. Jan 2001; 6(1): 71–77.
PMCID: PMC434385

The hsp60B gene of Drosophila melanogaster is essential for the spermatid individualization process

Abstract

The 60-kDa heat shock protein family (Hsp60) is found in prokaryotes, mitochondria, and chloroplasts. The Hsp60 proteins promote proper protein folding by preventing aggregation. In Drosophila melanogaster, the hsp60 gene is essential for a variety of developmental processes, beginning at early embryogenesis. In this study we show that an additional member of the Drosophila hsp60 gene family, hsp60B, is essential in male fertility. In males homozygous for a mutation of the hsp60B gene, developmental processes appeared normal throughout most of spermatogenesis, including spermatocyte growth, meiosis, and spermatid elongation. At these stages, mitochondria also displayed a differentiation process similar to wild-types. However, we found that the mutation disrupted a late stage of spermatogenesis, the spermatid individualization process. In this process, the individualization complex is assembled at spermatid nuclear heads, traverses along spermatid tails, and generates membranes for each of the spermatids in a cyst. Our analysis further shows that the individualization complex in sterile males displayed abnormal morphology as it was traveling along the spermatid tails. The Drosophila Hsp60 proteins are believed to be exclusively localized in the mitochondria. Our observation that the hsp60B mutation displayed no apparent defect in mitochondrial differentiation during spermatogenesis suggests that the Hsp60B protein may operate in a nonmitochondrial location.

INTRODUCTION

Genetic studies have shown that heat shock proteins (Hsps) in multicellular organisms play critical roles in a variety of developmental processes. For example, the hsp83 gene of Drosophila is essential for tyrosine kinase signaling (Cutforth and Rubin 1994), Raf-mediated signaling (Van Der Straten et al 1997), and spermatogenesis (Yue et al 1999). The hsp70-2 gene of mouse is required exclusively in spermatogenesis. Male knockout mice with a defective hsp70-2 gene were sterile, displaying spermatogenic arrest in prophase of meiosis I and the late pachytene stage (Eddy 1999).

The Hsp60 proteins are molecular chaperones and are found in the cytosol of bacteria, chloroplasts, and mitochondria (Ellis and Van Der Vies 1991). In Drosophila melanogaster, the Hsp60 protein is located exclusively in the mitochondria (San Martin et al 1995) and plays essential roles from the early stages of embryogenesis (Kozlova et al 1997). Many mutations in the hsp60 gene cause recessive lethality at the embryonic or larval stages of fly development (Zhimulev et al 1987; Perezgasga et al 1999). In addition, several alleles of the hsp60 gene also showed conditional phenotypes that were dependent on the rearing temperature. Whereas some heat-sensitive alleles induced lethality at high temperature, other cold-sensitive alleles cause female infertility at low temperature (Zhimulev et al 1987).

A genomic DNA sequence that encodes a second hsp60 gene of Drosophila melanogaster has been recently revealed in the studies of the Drosophila Genome Project (GenBank accession number AE003588; Adams et al 2000; Rubin et al 2000). This new hsp60 gene is named hsp60B, and its predicted protein product has 648 amino acids (AAF51467.1). Similar to the high conservation of homology among other members of the Hsp60 protein family, the predicted Hsp60B protein shares extensive homology with the Drosophila Hsp60 protein. We analyzed a mutation of the hsp60B gene that causes male sterility and here show that the hsp60B gene is required for the spermatid individualization process.

MATERIALS AND METHODS

Drosophila strains and genetic crosses

D. melanogaster strains were grown on standard corn meal/agar media (Ashburner 1989) at 25°C. The strains and mutations were those as described in Lindsley and Zimm (1992). The strain carrying the hsp60B1 allele was obtained from the Bloomington Drosophila Stock Center (Bloomington, IN).

Polymerase chain reactions

Genomic DNA samples were isolated from adult flies as described elsewhere (Ashburner 1989). Two hsp60B-specific primers were G1 (ATGTTGTGAAATCTGGCG) and G2 (ATTTGCGAGAGTCCAGTG; Adams et al 2000; Rubin et al 2000). Two P element-specific primers were 5′-Pend (CGACGGGACCACCTTATGTTATTTCATCATG) and 3′- Pend (AGTGGATGTCTCTTGCCGAC; Rubin and Spradling 1983).

Examination of spermatogenesis by phase-contrast microscopy

Testes were dissected out in phosphate-buffered saline (PBS) from 1- to 3-day-old males and transferred to a drop of PBS saline (130 mM NaCl, 7 mM Na2HPO4, 3 mM NaH2PO4 pH 7.0) on a glass slide. The testes were torn open and squashed under the weight of a cover slip (Kemphues et al 1980). The morphology of primary and secondary spermatocytes, as well as round and elongated spermatids, was examined under an Olympus Provis Microscope equipped with phase-contrast optical lenses.

Staining of testes with MitoTracker Red CMXRos

Testes of 1- to 3-day-old males were removed in PBS and stained in MitoTracker Red CMXRos in PBS (Molecular Probes, Eugene, OR, USA) at various concentrations (0.01, 0.1, 1, and 10 μM) for 15 minutes at room temperature. Tissues were rinsed twice in PBS, transferred to a drop of PBS on a glass slide, and torn open in PBS with sharp forceps. The samples were mounted in PBS and examined under an Olympus Provis Microscope equipped with filters to observe fluorescent illumination.

Staining of testes with fluorescein-phalloidin, MitoTracker Red CMXRos, and DAPI

Testes were removed from 1- to 3-day-old males in PBS and fixed for 10 minutes in 6% formaldehyde in phosphate buffer (16 mM KH2PO4/K2HPO4 pH 6.8, 75 mM KCl, 25 mM NaCl, 4 mM MgCl2). Tissues were washed twice for 5 minutes each with PBS and stained for 20 minutes with fluorescein-conjugated phalloidin at 8 U/ mL in PBS (Molecular Probes). Tissues were then washed twice for 5 minutes each in PBS and stained for 10 minutes with 100 nM MitoTracker Red CMXRos in PBS. Tissues were washed twice for 5 minutes each in PBS and stained with DAPI (0.5 μg/mL in PBS). After staining, individual testes were transferred into 10 μL DAPI staining solution on a coverslip. The sheath of the testes was removed as described previously (Timakov and Zhang 2000) and the samples were mounted in Prolong antifade solution (Molecular Probes). The fluorescent images were taken by using an Olympus Provis microscope and a cooled CCD digital camera (SPOT, Diagnostic Instruments Inc, Sterling Heights, MI). The composite images were processed by using Adobe Photoshop software (Adobe Systems Inc) on an Apple computer.

RESULTS AND DISCUSSION

The hsp60B gene is disrupted by a P element insertion

The hsp60B gene is located in polytene band 21D on chromosome 2, which was determined by cytogenetic and sequence analysis (Adams et al 2000; Rubin et al 2000). Comparison of the predicted amino acid sequence of Hsp60B with that of the Hsp60 protein located in 10A4– 6 on the X chromosome, using the Gapped BLAST program (Altschul et al 1997), showed that Hsp60B shares approximately 60% amino acid identity with Hsp60 along the entire length of the protein sequences. For example, the N-terminal sequence of Hsp60B shares 75% amino acid identity with that of Hsp60 (89/118), as shown in Figure 1. A similar level of homology is also observed with other members of the Hsp60 protein family, including human Hsp60 (accession number A32800) and mouse Hsp60 (accession number CAA37653).

figure i1355-8145-006-01-0071-f01
Fig 1. Alignment of the Hsp60B N-terminal sequence with that of Hsp60 (accession number CAA67720). Identical residues are shown as white on black ...

A strain carrying a genetically engineered P element, the PZ element, inserted into the 5′-UTR of the hsp60B gene, has been discovered (Spradling et al 1995, 1999). We obtained a stock carrying this hsp60B1 allele and confirmed the position of the inserted transposon by polymerase chain reaction (PCR). Pairs of primers derived from the genomic sequence of the hsp60B gene and the ends of the transposon produced the predicted products (Fig 2). Two PCR primers specific for the hsp60B genomic sequence (G1 and G2, Fig 2A) produced a predicted product of 1075 base pairs (bp) when DNA from wild- type flies was used (Fig 2B, lane 1). Because the PZ insertion in hsp60B1 is between G1 and G2, this primer set produced no product from DNA of the hsp60B1/hsp60B1 flies (Fig 2B, lane 2). Other amplifications of DNA from the hsp60B1/hsp60B1 flies gave rise to the expected products. For example, the G1 and a P element-specific primer, 5′-Pend, produced a 335-bp fragment (Fig 2B, lane 3), whereas the G2 and another P element-specific primer, 3′-Pend, produced an 821 bp fragment (Fig 2B, lane 4). The results confirm that the hsp60B gene is disrupted in the 5′-UTR by the P element insertion.

figure i1355-8145-006-01-0071-f02
Fig 2. The hsp60B gene is disrupted in the hsp60B1 allele. (A) A schematic drawing of the hsp60B gene structure. The open reading frame and a cDNA sequence of the hsp60B gene are indicated as ORF and cDNA (GenBank accession number ...

The P element in the hsp60B1 allele causes male sterility

The hsp60B1 allele is located on a second chromosome that carries a recessive male sterile mutation (Castrillon et al 1993). The male sterile mutation has been previously mapped to the polytene region, where the PZ element insertion is located, because it is sterile when heterozygous with a deficiency, Df(3L)ast1, which carries a deletion from 21C to 23A (Spradling et al 1999). To determine if the hsp60B1 allele is the cause of male sterility, we carried out a P element reversion experiment (Cooley et al 1988) to restore male fertility by excising the PZ element insertion in the hsp60B1 allele. The PZ element in hsp60B1 carries a genetic marker, the rosy+ gene, which gives rise to red eye color. By activating the PZ element with a transposase source, Δ2-3 (Robertson et al 1988), 16 lines that showed rosy eye color were generated from the hsp60B1 chromosome. Male fertility in 4 lines was restored when combined with the starting chromosome, demonstrating that the PZ element insertion that disrupts the hsp60B gene causes male sterility. The rest of the 12 lines with rosy eye color were viable, but remained male sterile.

Postmeiotic defects induced by the hsp60B1 allele

The hsp60B1/hsp60B1 males displayed normal spermatogenesis until postmeiotic spermatid differentiation (Castrillon et al 1993). In these males, primary spermatocytes were produced and grew in a cyst of 16 cells (Fig 3). The mature primary spermatocytes (Fig 3B) entered meiosis to produce 64 spermatids in a cyst (Fig 3C), as in wild- type. It is interesting that phase-contrast microscopic examination also showed no significant difference of mitochondrial morphology in round spermatids between hsp60B1/hsp60B1 males and wild-type males (for review, see Fuller 1993). As shown in Figure 3C, mitochondria aggregated around each nuclei of round spermatids to form a mitochondrial derivative in hsp60B1/hsp60B1 males, as in wild-types. During the subsequent spermatid differentiation processes, the round spermatids elongated and grew into a normal-looking bundle of 64 tails (Fig 3D). However, spermatogenesis in hsp60B1/hsp60B1 males showed an obvious departure from normal development after spermatid elongation. Whereas individual motile sperm were produced abundantly at the base of the testes in wild-type males (Fig 3E), no motile sperm were present in hsp60B1/hsp60B1 males. Instead, a large amount of debris was found at the base of the mutant testes, including degraded fragments of the spermatid tails (Fig 3F).

figure i1355-8145-006-01-0071-f03
Fig 3. Phase-contrast microscopic analysis of spermatogenesis in hsp60B1/hsp60B1 males. (A) The sizes of primary spermatocytes grew extensively, as in wild-types (from left to right). (B) A cyst of 16 mature primary spermatocytes is shown. (C) ...

We further examined the mitochondrial morphology of spermatids in hsp60B1/hsp60B1 males by using a fluorescent dye, MitoTracker Red CMXRos, which selectively stains mitochondria (Poot et al 1996). No significant structural difference of the mitochondrial derivatives was found in round and elongating spermatids between hsp60B1/hsp60B1 males and wild-type males. Brightly stained mitochondrial derivatives were seen around each of the 64 spermatid nuclei in a cyst, as in wild-types (Fig 4A). The spermatid tails, composed mainly of the mitochondrial derivatives, elongated and grew extensively (Fig 4B, C) to a length of approximately 1.8 mm (Ashburner 1989). Moreover, the staining intensity in the mitochondrial derivatives of the mutant males was also similar to that of wild-types. These results were obtained at various concentrations of the MitoTracker Red CMXRos dye, ranging from 10 nM to 10 μM. The data suggest that disruption of the hsp60B gene caused no extensive damage to the mitochondrial structure in spermatids. In addition, because the uptake of this cell-permeant dye is dependent on mitochondrial membrane potential (Poot et al 1996), our analysis of live tissues (Fig 4) suggests that disruption of the hsp60B gene has little or no effect on the mitochondrial membrane potential of spermatids.

figure i1355-8145-006-01-0071-f04
Fig 4. The mitochondrial differentiation of spermatogenesis in hsp60B1/hsp60B1 testes stained with MitoTracker Red CMXRos. (A) The mitochondria have aggregated in a cyst of 64 round spermatids after the meiotic divisions. Adjacent to each nucleus ...

The hsp60B gene is essential for the spermatid individualization process

As shown in Figure 3, phase-contrast microscopy revealed that hsp60B1/hsp60B1 males failed to produce individualized spermatids, suggesting a defect in the spermatid individualization process. We examined the individualization complex that assembles at the aligned nuclear heads of the spermatid bundle, traverses along the spermatid tails, and resolves the syncytial spermatids of a cyst into 64 cells with individual membranes (Lindsley and Tokuyasu 1980; Fuller 1993). The individualization complex is rich in F-actin and is readily observable by staining the testes with phalloidin (Fabrizio et al 1998; Timakov and Zhang 2000). In hsp60B1/hsp60B1 males, the individualization complex was assembled onto the nuclear heads of the spermatid bundle as in wild-types (Fig 5A, C). In wild-types, the individualization complex with aligned 64 cone-shaped components (Fig 5B) traversed along the tails toward the apical tip of the testes to resolve individual spermatids. In contrast, although the individualization complex in hsp60B1/hsp60B1 males traversed along the tails, it displayed an abnormal morphology of loosely connected, cone-shaped components (Fig 5D). Moreover, the abnormal individualization complex was never seen at the apical tip of the testes, suggesting that it failed to reach the ends of the tails. Thus, the individualization process in hsp60B1/hsp60B1 males was likely incomplete. This may lead to the degradation of defective spermatid bundles (Fig 3F) before they were transferred into the seminal vesicles where mature sperm are stored.

figure i1355-8145-006-01-0071-f05
Fig 5. The spermatid individualization process in hsp60B1/hsp60B1 males. In wild-type (A) and hsp60B1/hsp60B1 testes (C), F-actin-rich individualization complexes (green, stained with fluorescein phalloidin, arrow) were assembled onto the aligned ...

In summary, the results presented in this report thus show that the hsp60B gene plays a critical role in the spermatid individualization process because hsp60B1/hsp60B1 males failed to produce individualized spermatids (Fig 3E, F). Unlike the function of the hsp60 gene, which is required for a variety of fly developmental processes (Zhimulev et al 1987; Kozlova et al 1997; Perezgasga et al 1999), the function of the hsp60B gene is probably confined in the development of the male germ line. This is because the hsp60B1 allele had no effect on viability or female fertility when the flies were reared at temperatures ranging from 18°C to 28°C (data not shown). In addition, none of the 12 new alleles recovered after P element excision displayed a defect other than male infertility, indicating that the hsp60B gene is essential exclusively in spermatogenesis. Furthermore, because the earliest departure of spermatogenesis in hsp60B1/hsp60B1 males from that of wild-type males was not seen until the spermatid individualization process (Figs (Figs33 and and5),5), the function of the hsp60B gene may be further limited within this stage of spermatogenesis.

Immunoelectron microscopy studies using a polyclonal Hsp60 antibody have suggested that the Hsp60 protein is exclusively localized within the mitochondria of embryonic Drosophila cells (San Martin et al 1995). Thus, the functions of the hsp60 genes may be restricted within the mitochondria of Drosophila cells because the Hsp60 proteins appear to be localized only in these cellular organelles. In Drosophila spermatogenesis, mitochondria undergo extensive differentiation, including aggregation to form the mitochondrial derivatives in round spermatids and elongation to form spermatid tails (see Figs Figs33 and and4;4; reviewed in Lindsley and Tokuyasu 1980; Fuller 1993). The hsp60B1 mutation appears to have no effect on these mitochondrial differentiation processes because the mitochondrial morphology in hsp60B1/hsp60B1 testes, as well as the uptake of the MitoTracker dye that is dependent on the mitochondrial membrane potential, showed no significant deviation from that of wild-types.

However, a defect at a later stage of spermatogenesis (ie, the spermatid individualization process), was revealed in hsp60B1/hsp60B1 males. Furthermore, this defect was associated with abnormal individualization complexes displaying loosely connected individual components that traversed along the spermatid tails (Fig 5). Mitochondria are directly involved in the spermatid individualization process because the Drosophila spermatid tail is composed mainly of 2 mitochondrial structures, the major and minor mitochondrial derivatives, which are differentiated from the mitochondrial derivative in the round spermatid (Lindsley and Tokuyasu 1980; Fuller 1993). Thus, our observation that the hsp60B1 mutation disrupted the spermatid individualization process is consistent with a hypothesis that the Hsp60 proteins play critical roles exclusively in the mitochondria of Drosophila cells. It is possible that the hsp60B1 mutation has caused a failure in proper protein folding (Fink 1999), leading to some structural defects in the mitochondrial derivatives of spermatid tails. These defects may hinder the operation of the individualization complex, resulting in incomplete spermatid individualization and male sterility.

The Hsp60 proteins have also been implicated in cellular activities outside the mitochondria. For example, studies have shown that these proteins are involved in the A- and L-systems of amino acid transport, signal transduction, and peptide presentation (Ikawa and Weinberg 1992; Jones et al 1994; Wells et al 1997; Woodlock et al 1997). In addition, the Hsp60 proteins have been found in several cellular organelles and on the surface of different cell types (reviewed in Soltys and Gupta 1999). Our studies suggest that the hsp60B mutation did not interfere with the mitochondrial differentiation process during spermatogenesis. Thus, we cannot rule out a possibility that the Hsp60B protein may operate in a nonmitochondrial compartment. For a nuclear-encoded and mitochondrial-matrix protein, such as Hsp60, to be relocalized into a nonmitochondrial compartment, one explanation could be that the protein is first imported into mitochondria but exported late through unknown mechanisms (Soltys and Gupta 1999). Alternatively, it is possible that the Hsp60B protein is not a mitochondrial protein. The Hsp60 protein is synthesized as a precursor that contains an N-terminal mitochondrial targeting sequence, which is subsequently cleaved. It is interesting that the N-terminal sequence of Hsp60B shows peculiar differences from that of Hsp60. First, comparison between the Hsp60B and Hsp60 sequences revealed that the first 21 amino acid residues are less conserved (10/21, or 48% amino acid residue identity) than other regions of the N-terminal sequences. For example, amino acid residues 22–118 show 80% amino acid residue identity (78/97), as shown in Figure 1. Second, sequence alignment of Hsp60B with that of Hsp60 shows only 3 gaps of single amino acid residues throughout the entire length of the proteins, except the C-termini. Two of these gaps are located within the first 20 amino acid residues of the N-terminal sequences (dashes in Fig 1). Although various mitochondrial targeting sequences are poorly characterized and display no obvious sequence homology (Watson 1984), the intriguing difference of the N-terminal sequences between Hsp60B and Hsp60 raises a possibility that Hsp60B does not contain an N-terminal mitochondrial targeting sequence.

Acknowledgments

We thank the Bloomington Drosophila Stock Center for providing the hsp60B1 allele and the University of Connecticut Biotechnology Center for generating oligonucleotides. This work was supported in part by US National Science Foundation grant MCB-0077817 and by a grant from the University of Connecticut Research Advisory Council.

REFERENCES

  • Adams MD, Celniker SE, Holt RA, et al. The Genome Sequence of. Drosophila melanogaster. Science. 2000;287:2185–2179. [PubMed]
  • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. [PMC free article] [PubMed]
  • Ashburner M 1989.  Drosophila: A Laboratory Handbook and Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • Castrillon D, Gonczy P, Alexander S, Rawson R, Eberhart C, Viswanathan S, DiNardo S, Wasserman S. Towards a molecular genetic analysis of spermatogenesis in Drosophila melanogaster: characterization of male-sterile mutants generated by single P element mutagenesis. Genetics. 1993;135:489–505. [PMC free article] [PubMed]
  • Cooley L, Kelley R, Spradling A. Insertional mutagenesis of the Drosophila genome with single P-elements. Science. 1988;239:1121–1128. [PubMed]
  • Cutforth T, Rubin GM. Mutations in hsp83 and cdc37 impair signaling by the sevenless receptor tyrosine kinase in Drosophila. Cell. 1994;77:1027–1036. [PubMed]
  • Eddy EM. Role of heat shock protein HSP70-2 in spermatogenesis. Rev Reprod. 1999;4:23–30. [PubMed]
  • Ellis RJ, Van Der Vies SM. Molecular chaperones. Annu Rev Biochem. 1991;60:321–347. [PubMed]
  • Fabrizio JJ, Hime G, Lemmon SK, Bazinet C. Genetic dissection of sperm individualization in Drosophila melanogaster. Development. 1998;125:1833–1843. [PubMed]
  • Fink AL. Chaperone-mediated protein folding. Physiol Rev. 1999;79:425–449. [PubMed]
  • Fuller M 1993.  Spermatogenesis. In: The Development of Drosophila melanogaster, ed Bate M, Martinez A. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 71–147.
  • Ikawa S, Weinberg RA. An interaction between p21ras and heat shock protein hsp60, a chaperonin. Proc Natl Acad Sci USA. 1992;89:2012–2016. [PMC free article] [PubMed]
  • Jones M, Gupta RS, Englesberg E. Enhancement in amount of P1 (hsp60) in mutants of Chinese hamster ovary (CHO-K1) cells exhibiting increases in the A system of amino acid transport. Proc Natl Acad Sci USA. 1994;91:858–862. [PMC free article] [PubMed]
  • Kemphues K, Raff E, Raff R, Kaufman T. Mutation in a testis- specific β-tubulin in Drosophila: analysis of its effects on meiosis and map location of the gene. Cell. 1980;21:445–451. [PubMed]
  • Kozlova T, Perezgasga L, Reynaud E, Zurita M. The Drosophila melanogaster homologue of the hsp60 gene is encoded by the essential locus l(1)10Ac and is differentially expressed during fly development. Dev Genes Evol. 1997;207:253–263.
  • Lindsley D, Tokuyasu KT 1980.  Spermatogenesis. In: Genetics and Biology in Drosophila, 2nd edition, ed Ashburner M, Wright T. Academic Press, New York, 225–294.
  • Lindsley D, Zimm G 1992.  The genome of Drosophila melanogaster. Academic Press, New York.
  • Perezgasga L, Segovia L, Zurita M. Molecular characterization of the 5′ control region and of two lethal alleles affecting the hsp60 gene in Drosophila melanogaster. FEBS Lett. 1999;456:269– 273. [PubMed]
  • Poot M, Zhang YZ, Kramer JA, et al. Analysis of mitochondrial morphology and function with novel fixable fluorescent stains. J Histochem Cytochem. 1996;44:1363–1372. [PubMed]
  • Robertson HM, Preston CR, Phillis RW, Johnson-Schlitz DM, Benz WK, Engels WR. A stable genomic source of P-element transposase in Drosophila melanogaster. Genetics. 1988;118:461–470. [PMC free article] [PubMed]
  • Rubin GM, Spradling AC. Vectors for P element-mediated gene transfer in Drosophila. Nucleic Acids Res. 1983;11:6341–6351. [PMC free article] [PubMed]
  • Rubin GM, Yandell MD, Wortman JR, et al. Comparative genomics of the eukaryotes. Science. 2000;287:2204–2215. [PMC free article] [PubMed]
  • San Martin C, Flores AI, Cuezva JM. Cpn60 is exclusively localized into mitochondria of rat liver and embryonic Drosophila cells. J Cell Biochem. 1995;59:235–245. [PubMed]
  • Soltys BJ, Gupta RS. Mitochondrial-matrix proteins at unexpected locations: are they exported? Trends Biochem Sci. 1999;24:174– 177. [PubMed]
  • Spradling AC, Stern D, Beaton A, Jay Rhem E, Laverty T, Mozden N, Misra S, Rubin GM. The BDGP Gene Disruption Project: single P lement insertions mutating 25% of vital Drosophila genes. Genetics. 1999;153:135–177. [PMC free article] [PubMed]
  • Spradling AC, Stern DM, Kiss I, Roote J, Laverty T, Rubin GM. Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc Natl Acad Sci U S A. 1995;92:10824–10830. [PMC free article] [PubMed]
  • Timakov B, Zhang P. Genetic analysis of a Y chromosome region that contains a triplosterile locus and is essential for spermatid individualization in Drosophila melanogaster. Genetics. 2000;155:179–189. [PMC free article] [PubMed]
  • Van Der Straten A, Rommel C, Dickson B, Hafen E. The heat shock protein 83 (Hsp83) is required for Raf-mediated signaling in Drosophila. EMBO J. 1997;16:1961–1969. [PMC free article] [PubMed]
  • Watson ME. Compilation of published signal sequences. Nucleic Acids Res. 1984;12:5145–5164. [PMC free article] [PubMed]
  • Wells AD, Rai SK, Salvato MS, Band H, Malkovsky M. Restoration of MHC class I surface expression and endogenous antigen presentation by a molecular chaperone. Scand J Immunol. 1997;45:605–612. [PubMed]
  • Woodlock TJ, Chen X, Young DA, Bethlendy G, Lichtman MA, Segel GB. Association of HSP60-like proteins with the L-system amino acid transporter. Arch Biochem Biophys. 1997;338:50–56. [PubMed]
  • Yue L, Karr TL, Nathan DF, Swift H, Srinivasan S, Lindquist S. Genetic analysis of viable hsp90 alleles reveals a critical role in Drosophila spermatogenesis. Genetics. 1999;151:1065–1079. [PMC free article] [PubMed]
  • Zhimulev IF, Pokholkova GV, Bgatov AB, Umbetova GH, Solov'eva IV, Khudyakov YE, Belyaeva ES. Fine cytogenetical analysis of the band 10A1-2 and the adjoining regions in the Drosophila melanogaster X-chromosome. Biol Zentbl. 1987;106:699–720.

Articles from Cell Stress & Chaperones are provided here courtesy of Cell Stress Society International
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • EST
    EST
    Published EST sequences
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...