Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. May 14, 2013; 110(20): 8224–8229.
Published online Apr 8, 2013. doi:  10.1073/pnas.1220285110
PMCID: PMC3657792
From the Cover
Neuroscience

Conserved MIP receptor–ligand pair regulates Platynereis larval settlement

Abstract

Life-cycle transitions connecting larval and juvenile stages in metazoans are orchestrated by neuroendocrine signals including neuropeptides and hormones. In marine invertebrate life cycles, which often consist of planktonic larval and benthic adult stages, settlement of the free-swimming larva to the sea floor in response to environmental cues is a key life cycle transition. Settlement is regulated by a specialized sensory–neurosecretory system, the larval apical organ. The neuroendocrine mechanisms through which the apical organ transduces environmental cues into behavioral responses during settlement are not yet understood. Here we show that myoinhibitory peptide (MIP)/allatostatin-B, a pleiotropic neuropeptide widespread among protostomes, regulates larval settlement in the marine annelid Platynereis dumerilii. MIP is expressed in chemosensory–neurosecretory cells in the annelid larval apical organ and signals to its receptor, an orthologue of the Drosophila sex peptide receptor, expressed in neighboring apical organ cells. We demonstrate by morpholino-mediated knockdown that MIP signals via this receptor to trigger settlement. These results reveal a role for a conserved MIP receptor–ligand pair in regulating marine annelid settlement.

Metazoan life cycles show great diversity in larval, juvenile, and adult forms, as well as in the timing and ecological context of the transitions between these forms. In many animal species, neuroendocrine signals involving hormones and neuropeptides regulate life cycle transitions (13). Environmental cues are often important instructors of the timing of life cycle transitions (4), and can affect behavioral, physiological, or morphological change via neuroendocrine signaling (5).

Marine invertebrate larval settlement is a prime example of the strong link between environmental cues and the timing of life-cycle transitions. Marine invertebrate life cycles often consist of a free-swimming (i.e., pelagic) larval stage that settles to the ocean floor and metamorphoses into a bottom-dwelling (i.e., benthic) juvenile (68). In many invertebrate larvae, a pelagic–benthic transition is induced by chemical cues from the environment (9, 10). Larval settlement commonly includes the cessation of swimming and the appearance of substrate exploratory behavior, including crawling on or attachment to the substrate (1114). In diverse ciliated marine larvae (15), the apical organ, an anterior cluster of larval sensory neurons (16) with a strong neurosecretory character (1720), has been implicated in the detection of cues for the initiation of larval settlement (21). Although molecular markers of the apical organ have been described (2224), our knowledge of the neuroendocrine mechanisms with which apical organ cells transmit signals to initiate larval settlement behavior is incomplete.

Here, we identify a conserved myoinhibitory peptide (MIP)/allatostatin-B receptor–ligand pair as a regulator of larval settlement behavior in the marine polychaete annelid Platynereis dumerilii. MIPs are pleiotropic neuropeptides (25) first described in insects as inhibitors of muscle contractions (26, 27). In some insect species, MIPs modulate juvenile hormone (28) or ecdysone synthesis (29), and are also referred to as allatostatin-B or prothoracicostatic peptide (30, 31). These peptides are known to signal via a G protein-coupled receptor, the sex peptide receptor (SPR) (31, 32). MIPs show sequence similarity to cnidarian GLWamides and belong to an ancestral eumetazoan Wamide family that also includes mollusk APGWamides and other peptides (33). We found that Platynereis MIP is expressed in chemosensory–neurosecretory cells in the apical organ and triggers larval settlement behavior by signaling via an SPR orthologue expressed in adjacent apical organ cells. Our results identify a conserved neuropeptide receptor–ligand pair in the apical organ, which may transduce environmental signals to initiate settlement in a pelagic–benthic life cycle.

Results

MIP Triggers Larval Settlement in Platynereis.

Platynereis has a pelagic–benthic life cycle with a freely swimming ciliated larval stage that spends as long as several days in the plankton before transitioning to a benthic lifestyle (34, 35). Searching for regulators of annelid settlement, we identified a neuropeptide, an orthologue of arthropod MIP (Fig. S1 A and B), that efficiently triggers settlement of Platynereis larvae. The peptide is derived from a precursor protein that shows high sequence similarity to the MIP preprotein from the distantly related polychaete Capitella teleta (36, 37) and to MIP precursors from arthropods (also called allatostatin-B or prothoracicostatic peptide) (30). The predicted mature protostome MIP peptides share a conserved W(X5–8)W sequence motif and are amidated (Fig. S1B). We did not identify any MIP orthologue in deuterostomes.

Treatment of free-swimming Platynereis larvae in a vertical swimming assay (19) with synthetic Platynereis MIP peptide rapidly induced downward vertical movement in trochophore and nectochaete larval stages (Fig. 1A, Fig. S2, and Movies S1, S2, and S3), an effect that could be reversed by washout (Fig. 1A). Different versions of MIPs derived from the same Platynereis precursor protein, including a nonamidated MIP, also rapidly triggered larval sinking (Fig. S2 AE). We focused on MIP7 in subsequent experiments because this peptide closely matches the consensus sequence derived from all Platynereis MIPs (Fig. S1 C and D). Substitution of the last (W10A), but not the first (W2A), tryptophan residue to alanine rendered MIP7 inactive in the vertical swimming assay (Fig. 1A). To understand the mechanism of downward movement, we analyzed the effects of MIP7 treatment on ciliary activity. MIP7 did not significantly alter the beat frequency of cilia (Fig. S2G), but triggered long and frequent ciliary arrests in a concentration-dependent manner (Fig. 1B). Close-up videos of 2-d-old larvae treated with MIP7 in the vertical column showed that the larvae were sinking with their anterior pointed upward (Movie S2). Larvae at age 3 d showed downward movement with their anterior pointed downward, implying more complex behavioral effects in older larvae (Movie S3).

Fig. 1.
MIP triggers larval settlement behavior in Platynereis. (A) Angular histograms of the displacement vectors of swimming tracks for larvae treated with DMSO (control) and larvae treated with the indicated peptide [n > 100 larvae (55–60 hpf) ...

After MIP7-treated larvae reached the bottom of the culture dish, they showed sustained exploratory crawling behavior, with frequent touching of the apical side to the substrate (Fig. 1 C and D and Movies S4 and S5). Such substrate exploratory behavior could also be observed at low frequency for control larvae, with late nectochaete stages [5–6 d postfertilization (dpf)] showing a greater tendency to contact the substrate. MIP7 treatment strongly induced sustained substrate contact between 1 and 6 d of development (Fig. 1C). Another Platynereis neuropeptide, AKYFLamide, which has previously been shown to trigger larval sinking (19), was inactive in the crawling assay even after 90 min of incubation (Fig. 1D). Overall, MIP treatment can rapidly induce two distinct behaviors in Platynereis larvae: (i) inhibition of cilia and cessation of swimming and (ii) crawling on the substrate, both considered hallmarks of marine invertebrate larval settlement (1114). These results identify Platynereis MIP as a settlement-inducing neuropeptide.

MIP Is Expressed in Neurosecretory Annelid Apical Organ.

Whole-mount in situ hybridization on Platynereis larvae revealed MIP mRNA expression in sensory cells of the apical organ from 20 h postfertilization (hpf) on, as well as two pairs of cells in the trunk from 48 hpf on. The apical organ expression was observed in an increasing number of cells with age (Fig. 2 AD and Fig. S3 BH). Immunostaining with a specific MIP antibody (Fig. S3A) showed that the axonal projections of these cells terminate in the apical nerve plexus (Fig. 2 E and F), a region of strong neurosecretory activity (18, 19). By using the Platynereis MIP antibody or an antibody against the conserved C-amidated dipeptide VWamide that is strongly conserved in mollusks and annelids (Figs. S1B and S3A), we observed similar immunolabeling in sensory cells in the larval apical organ and in the nerve plexus of Capitella (Fig. 1 G and H and Fig. S3I).

Fig. 2.
MIP is expressed in apical organ neurons in Platynereis and Capitella. (A) SEM image of a 48-hpf Platynereis larva in ventral view. (B) Whole-mount mRNA in situ hybridization for Platynereis MIP (red) in a 48-hpf larva in ventral view. (C) SEM image of ...

To confirm the neurosecretory nature of the MIP-expressing cells, we analyzed MIP coexpression with known neuroendocrine markers by using image registration of in situ hybridization scans to an average anatomical reference template (19, 38, 39). We scanned, registered, and averaged at least five individual larvae per gene from whole-mount in situ hybridization samples. We analyzed the neurosecretory marker prohormone convertase prohormone convertase 2 (phc2) and the neuroendocrine transcription factors orthopedia (otp) (18) and dimmed (dimm) (Fig. S4 AD). In Drosophila, dimm directs the differentiation of neuroendocrine neurons and is coexpressed with MIP in the median brain (40, 41). In vertebrates, otp is required for the terminal differentiation of hypothalamic neuropeptidergic neurons (42). Image registration revealed that the average MIP signal colocalized with phc2, and partially overlapped with otp and dimm average gene expression patterns. Additionally, otp and dimm colocalized broadly in the Platynereis apical organ neurons (Fig. S4 EJ). These results indicate that the MIP neurons are part of the neurosecretory apical organ.

Platynereis MIP Neurons Have Dual Chemosensory–Neurosecretory Function.

To investigate the sensory modality of the MIP neurons, we performed dye-filling experiments on live 30-h-old Platynereis larvae. In nematodes, dye-filling is the exclusive property of chemosensory neurons (43). Upon incubation of the larvae with fluorescent MitoTracker dye, we observed labeling of several flask-shaped neurons in the larval episphere, with long apical microvilli at the tip of their dendrites, including two prominent apical organ cells (Fig. 3 A and B). Laser ablation of these two apical organ cells, followed by subsequent fixation and MIP immunostaining, identified the cells as the two median MIP sensory neurons (Fig. 3 AD, arrowheads). The dye-filling results together with the characteristic microvillar morphology of the MIP neurons suggest that these cells likely have a chemosensory function.

Fig. 3.
Platynereis MIP neurons are chemosensory and neurosecretory. (A and B) Chemosensory neurons with long microvilli in the apical organ filled with MitoTracker dye in a 37-hpf Platynereis larva. Arrowheads indicate two prominently labeled apical organ cells, ...

To further characterize the morphology of the MIP neurons in Platynereis at an ultrastructural level, we traced the entire volume of two MIP cells (Figs. 2 D and E and and3C,3C, arrows) by using serial-sectioning transmission EM (TEM). In a dataset of 664 ultrathin sections (50 nm), we identified these two ventral MIP neurons based on the position of their cell bodies relative to large adjacent secretory gland cells and the characteristic shape and position of their dendrites and axons (Fig. S5 and Movies S6 and S7). Both identified neurons have a sensory dendrite with a cilium and long apical microvillar extensions surrounding the central cilium, characteristic of annelid chemosensory neurons (44) (Fig. 3E). These extensions run at the basal side of the cuticle in a subcuticular space that is permeable to seawater. The axons project to the dense apical nerve plexus of the larva, where they branch extensively (Fig. 3 F and G and Movie S7). We observed that the branched axons are full of large dense-cored vesicles (Fig. 3H), but are completely devoid of synapses that are typical for cells containing classical neurotransmitters (45), indicating that these MIP chemosensory neurons signal exclusively via the release of neuropeptides.

Annelid MIP Peptides Signal via Conserved G Protein-Coupled Receptor.

In insects, MIP peptides signal via a G protein-coupled receptor, the SPR (31, 32). We identified the orthologues of insect SPRs in Platynereis and Capitella (Fig. S6) and tested whether these receptors could be activated by annelid MIP peptides. Ligand stimulation in CHO cells expressing the respective Platynereis or Capitella receptor, a bioluminescent Ca2+ reporter, and a promiscuous G protein (46, 47) showed that annelid MIP peptides are potent agonists for these receptors. Activation assays with increasing concentrations of ligand showed that Platynereis MIP activated the Platynereis receptor in the nanomolar range (EC50 of 10 nM; Fig. 4A). The activation was specific, as 12 other Platynereis neuropeptides (19, 45) did not activate the MIP receptor (Fig. 4B). Consistently, Capitella MIP activated the Capitella SPR orthologue (Fig. 4D). Substitution of the last, but not the first, tryptophan residue with alanine in the Platynereis and the Capitella synthetic peptides resulted in a loss of activity (Fig. 4 C and D), indicating that the conserved C-terminal tryptophan residue is crucial for receptor activation. This result is consistent with our observations in the vertical swimming assays (compare with Fig. 1A). We also found that MIP peptides from the two annelid species cross-activated the receptor from the other species (Fig. 4 C and D).

Fig. 4.
Annelid MIP peptides signal via a G protein-coupled receptor. (A) Dose–response curve of the Platynereis (Pdu) MIP receptor treated with varying concentrations of Platynereis MIP7. (B) Activation of the Platynereis MIP receptor by Platynereis ...

By using mRNA in situ hybridization, we found that the MIP-receptor is expressed in cells of the Platynereis apical organ, interspersed between the MIP-expressing neurons with little overlap (Fig. 4 E and F), as revealed by image registration. Average MIP-receptor expression also colocalizes with phc2, otp, and dimm average gene expression, indicating that these cells are also part of a neurosecretory apical organ system (Fig. S7).

We next asked if the observed effects of synthetic MIP peptides on Platynereis larval settlement were caused by signaling via the MIP receptor. To test this, we knocked down the Platynereis receptor by microinjecting two different translation-blocking morpholinos (MOs) and a control mismatch MO into fertilized Platynereis eggs. In MIP-receptor–knockdown larvae, we no longer observed an effect of MIP peptide on ciliary closures in 2-d-old larvae, showing that MIP triggers settlement behavior by signaling via the MIP receptor (Fig. 4G).

Discussion

MIP Orchestrates Platynereis Larval Settlement Behavior via Neuroendocrine Signaling in Apical Organ.

Understanding the molecular machinery that operates within larval sensory structures is essential to our understanding of how the environment shapes larval behavior and development. The behavior evoked by synthetic MIP in Platynereis larvae mimics the settlement behavior described for other marine larvae upon encountering a natural inductive settlement cue (1114), suggesting that MIP activates a behavioral program for settlement. In laboratory culture, in the apparent absence of a cue, Platynereis larvae gradually transition from a pelagic to a benthic lifestyle over a period of approximately 6 d (35). Our results suggest that, were favorable chemical cues encountered, larvae would be competent to transition to a benthic lifestyle at an earlier stage. This is supported by the early expression of the MIP precursor in sensory cells of the apical organ and the strong settlement-inducing effects of MIP from early larval stages on. In early larvae, MIP is exclusively expressed in the apical organ (Fig. S3B); therefore, by adding exogenous peptide, we likely mimic the endogenous release of MIP from these apical sensory cells following chemosensory stimulation. A direct demonstration of this model will require the identification of the currently unknown settlement-inducing chemicals for Platynereis and their chemoreceptors in the MIP cells, in combination with genetic manipulations to show a link among environmental chemical cues, chemoreceptors, and settlement.

The integrative nature of the settlement behaviors induced by MIP (sinking followed by substrate exploration) is characteristic of neuroendocrine signaling, which can act simultaneously on a number of neurons and genes within an organism (48, 49). In Platynereis, several other neuropeptides are expressed in sensory neurons in the apical organ and regulate larval swimming depth during the pelagic phase of the life cycle (19). MIP is unique among these neuropeptides in that it can trigger rapid sinking and substrate exploratory behavior. The expression of the MIP precursor broadens and MIP effects become more complex with age, implying an elaboration of MIP targets during development.

The chemosensory MIP cells in the apical organ are also neurosecretory, as they have high concentrations of dense core vesicles and express the neurosecretory cell markers phc2, otp, and dimm. These cells could directly release MIP upon sensory stimulation. The expression of the MIP-receptor in apical organ cells adjacent to the MIP cells indicates that there is peptidergic paracrine signaling between the MIP sensory neurons and the receptor-expressing cells. The settlement-inducing effects of MIP were blocked by the MO-mediated knockdown of the receptor, indicating that the MIP receptor is required for the orchestration of peptide-induced settlement behavior. The molecular fingerprint of the MIP-receptor–expressing neurons shows that these cells are also neurosecretory and may release downstream signaling molecules in a neuroendocrine cascade.

Wamide Signaling: Ancestral Component of Eumetazoan Anterior Nervous System?

The conservation of MIP and its receptor in Platynereis and Capitella indicates that MIP signaling is widespread among annelids. MIP is also present in other Lophotrochozoans (Fig. S1) (50, 51). As for insects and annelids, the MIP receptor in the sea hare Aplysia californica is also an SPR orthologue (32).

In annelids and insects, a prominent domain of MIP expression is in the most anterior neurosecretory region of the developing brain (30), an area demarcated by the expression of the homeobox gene six3 (20). The MIP neurons in annelids and insect also express dimm and phc2. These similarities identify the MIP neurons as a conserved neurosecretory cell type in the anterior protostome brain. Although MIP seems to have been lost along the deuterostome lineage, the coexpression of dimm and otp in the Platynereis apical organ also supports a link among insect, annelid, and vertebrate neuroendocrine centers (18, 52).

Protostome MIPs belong to a diverse and ancient Wamide neuropeptide family that also includes cnidarian GLWamides (33), inducers of cnidarian larval metamorphosis (5355). In cnidarians, GLWamides are expressed in sensory cells at the anterior pole of the larva (8, 56). This anterior territory shares a conserved regulatory signature with apical organs in many bilaterian ciliated larvae (24, 57). MIP and LWamide may thus represent a conserved effector gene in the neurosecretory anterior brain of cnidarians and protostomes. The role of MIP in annelid settlement and LWamide in cnidarian metamorphosis suggests that one of the ancestral functions of Wamides may have been the regulation of a life cycle transition.

Methods

Gene Identification.

Platynereis genes were identified from expressed sequence tag (EST) sequences generated from a full-length normalized cDNA library from mixed larval stages. Capitella genes were identified at the Joint Genome Institute Genome Portal (58).

Behavioral Assays.

Platynereis larvae were obtained from an in-house breeding culture, following a previous publication (59). Vertical larval swimming and ciliary beating assays were performed and analyzed as previously described (19).

The substrate–contact assay was carried out in Nunclon 24-well tissue culture dishes or in customized quartz cuvettes. We increased the peptide concentration for 5-dpf and 6-dpf larvae from 20 μM to 50 μM because, in later stages, penetration of peptides could be impaired as a result of a thickening of the outer larval cuticle. After peptide application, sustained contact of the larva with the bottom of the tissue-culture dish was scored. A larva was scored to show sustained substrate contact behavior if it was in contact with the bottom of the dish for at least 5 s (75 frames in a 15 frames-per-second movie).

Antibodies and Tissue Staining.

Rabbit antisera against Platynereis MIP7 and against the conserved C-terminal VWamide motif were affinity-purified by using the respective peptides coupled to a SulfoLink resin (Thermo Scientific) via an N-terminal Cys (CAWNKNSMRVWamide and CVWamide) as previously described (60). In situ hybridization was performed as previously described (39).

Dye Filling and Laser Ablation.

MitoTracker red FM (50 μg; special packaging; Invitrogen) was freshly dissolved in 100 μL DMSO. The solution was added to 30-hpf larvae at 1:500 dilution and incubated for 1 h for optimal dye filling. Single larvae were mounted on a glass slide with two layers of adhesive tape on both sides in 20 μL natural seawater and covered with a coverslip to immobilize them. Dye-filled neurons were ablated on an Olympus FV1000 confocal microscope equipped with a 355 nm-pulsed laser (Teem Photonics) coupled via air and controlled by the SIM Scanner (Olympus). The ablated larvae were recovered, fixed at 48 or 52 hpf, and processed for anti-MIP immunostaining.

Light Microscopy and Image Registration.

Confocal imaging was performed as previously described (19). Image registration to a 48-hpf whole-body nuclear reference template and colocalization analysis were performed as previously described (39).

TEM.

Platynereis larvae (72 hpf) were frozen using a high-pressure freezer (BAL-TEC HPM 010; Balzers) and quickly transferred to liquid nitrogen. Frozen samples were treated with a substitution medium containing 2% (wt/vol) osmium tetroxide in acetone and 0.5% uranyl acetate in a cryosubstitution unit (EM AFS-2; Leica). The samples were cryosubstituted through gradually rising temperatures and embedded in Epon. Serial sections were cut at 50 nm on a Reichert Jung Ultracut E microtome and collected on single-slotted copper grids (NOTSCH-NUM 2 × 1 mm; Science Service) with Formvar support film, contrasted with uranyl acetate and Reynolds lead citrate, and carbon-coated to stabilize the film. Imaging of one specimen (Platynereis-72-HT-9-3) was performed at a pixel size of 3.87 nm on a TECNAI Spirit transmission electron microscope (FEI) equipped with an UltraScan 4000 4 × 4 k camera by using Digital Micrograph (Gatan) Stitching and alignment were done by using TrakEM2 (61). All structures were segmented manually as area lists, which were exported into 3Dviewer and Imaris.

Receptor Deorphanization.

Platynereis and Capitella SPR orthologues were cloned into a pcDNA3.1+ vector (Invitrogen) with HindIII and NotI. The Platynereis receptor was PCR-amplified from larval cDNA by using the primers 5′-ACAATAAAGCTTGCCACCATGATGGAAGTAAGCTATTCAAATGGAAATG (including HindIII site and Kozak consensus) and 5′-ACAATAGCGGCCGCTTAAATATTTGTAGTTTTAGTCGTGTGATCG (including NotI site), and the Capitella receptor clone used was a synthetic construct (GenScript). CHO-K1 cells stably expressing a calcium-sensitive bioluminescent fusion protein were transfected, and receptor activation was measured. Measurements were performed by using a fluorescent plate reader. The area under each calcium transient (measured for 1 min) was calculated by using Ascent software (Thermo Electron) and expressed as integrated luminescence units (relative units).

MO Injection.

For microinjections, fertilized Platynereis eggs developing at 16 °C were rinsed approximately 1 h after fertilization with sterile filtered seawater in a 100-μm sieve to remove the egg jelly, followed by treatment with 70 μg/mL proteinase K for 1 min to soften the vitellin envelope. Injections were carried out by using Femtotip II needles with a FemtoJet microinjector (Eppendorf) on a Zeiss Axiovert 40 CL inverted microscope equipped with a Luigs and Neumann micromanipulator. The temperature of the developing zygotes was maintained at 16 °C throughout injection by using a Luigs and Neumann Badcontroller V cooling system and a Cyclo 2 water pump (Roth).

Two translation-blocking MOs and one corresponding 5-bp mismatch control MO were designed to target the Platynereis MIP-receptor gene. MOs with the following sequences were purchased from Gene Tools: MIP-receptor-start1, TCCATCATTTTGAATGTTGAATGCA; MIP-receptor-mismatch, TCCATGATTTTCAATCTTCAATCCA; and MIP-receptor-start2, GTCAATGAGGTCACAAACATCCAAC. Nucleotides complementary to the start codon (ATG) are underlined; nucleotides altered in mismatch control MOs are denoted by boldface italics.

MOs were diluted in water with 12 μg/μL fluorescein dextran (Mr of 10,000 dalton; Invitrogen) as a fluorescent tracer. MOs (0.6 mM) were injected with an injection pressure of 600 hPa for 0.1 s and a compensation pressure of 35 hPa. Injected zygotes were kept in Nunclon six-well plates in 10 mL filtered seawater, and their development was monitored daily. Injected larvae at 48 hpf were used for ciliary resting measurements in the presence of 5 μM synthetic MIP7 peptide or DMSO as control.

Supplementary Material

Supporting Information:

Acknowledgments

We thank Harald Hausen for Capitella larvae; Detlev Arendt, Raju Tomer, Heidi Roebert, and Nicola Kegel for advice on Platynereis microinjection; and Aurora Panzera for help with microscopy. This work was supported by Max Planck Society Sequencing Grant M.IF.A.ENTW8050 (to G.J.). The research leading to these results was supported by the European Research Council under European Union Seventh Framework Programme FP7/2007–2013 and European Research Council Grant Agreement 260821.

Footnotes

Conflict of interest statement: A patent application on the potential use of MIP/allatostatin-B has been submitted.

This article is a PNAS Direct Submission.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. JX513876, JX513877, and JX513878).

See Commentary on page 7973.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1220285110/-/DCSupplemental.

References

1. Truman JW, Riddiford LM. The origins of insect metamorphosis. Nature. 1999;401(6752):447–452. [PubMed]
2. Heyland A, Moroz LL. Signaling mechanisms underlying metamorphic transitions in animals. Integr Comp Biol. 2006;46(6):743–759. [PubMed]
3. Laudet V. The origins and evolution of vertebrate metamorphosis. Curr Biol. 2011;21(18):R726–R737. [PubMed]
4. Gilbert SF. Ecological developmental biology: Environmental signals for normal animal development. Evol Dev. 2012;14(1):20–28. [PubMed]
5. Denver RJ. Stress hormones mediate environment-genotype interactions during amphibian development. Gen Comp Endocrinol. 2009;164(1):20–31. [PubMed]
6. Rieger RM. The biphasic life cycle—a central theme of metazoan evolution. Am Zool. 1994;34:484–491.
7. Hadfield MG. Why and how marine-invertebrate larvae metamorphose so fast. Semin Cell Dev Biol. 2000;11(6):437–443. [PubMed]
8. Hodin J. Expanding networks: Signaling components in and a hypothesis for the evolution of metamorphosis. Integr Comp Biol. 2006;46(6):719–742. [PubMed]
9. Pawlik J. Chemical ecology of the settlement of benthic marine invertebrates. Oceanogr Mar Biol. 1992;30:273–335.
10. Zimmer RK, Butman CA. Chemical signaling processes in the marine environment. Biol Bull. 2000;198(2):168–187. [PubMed]
11. Qian P. Larval settlement of polychaetes. Hydrobiologia. 1999;402:239–253.
12. Hadfield MG, Koehl MAR. Rapid behavioral responses of an invertebrate larva to dissolved settlement cue. Biol Bull. 2004;207(1):28–43. [PubMed]
13. Walters LJ, Miron G, Bourget E. Endoscopic observations of invertebrate larval substratum exploration and settlement. Mar Ecol Prog Ser. 1999;182:95–108.
14. Maldonado M, Young CM. Effects of physical factors on larval behavior, settlement and recruitment of four tropical demosponges. Mar Ecol Prog Ser. 1996;138:169–180.
15. Young CM, editor. Atlas of Marine Invertebrate Larvae. 1st Ed. San Francisco: Academic; 2002.
16. Nielsen C. Larval and adult brains. Evol Dev. 2005;7(5):483–489. [PubMed]
17. Page LR, Parries SC. Comparative study of the apical ganglion in planktotrophic caenogastropod larvae: Ultrastructure and immunoreactivity to serotonin. J Comp Neurol. 2000;418(4):383–401. [PubMed]
18. Tessmar-Raible K, et al. Conserved sensory-neurosecretory cell types in annelid and fish forebrain: Insights into hypothalamus evolution. Cell. 2007;129(7):1389–1400. [PubMed]
19. Conzelmann M, et al. Neuropeptides regulate swimming depth of Platynereis larvae. Proc Natl Acad Sci USA. 2011;108(46):E1174–E1183. [PMC free article] [PubMed]
20. Steinmetz PR, et al. Six3 demarcates the anterior-most developing brain region in bilaterian animals. Evodevo. 2010;1(1):14. [PMC free article] [PubMed]
21. Hadfield MG, Meleshkevitch EA, Boudko DY. The apical sensory organ of a gastropod veliger is a receptor for settlement cues. Biol Bull. 2000;198(1):67–76. [PubMed]
22. Rentzsch F, Fritzenwanker JH, Scholz CB, Technau U. FGF signalling controls formation of the apical sensory organ in the cnidarian Nematostella vectensis. Development. 2008;135(10):1761–1769. [PubMed]
23. Jackson DJ, et al. Developmental expression of COE across the Metazoa supports a conserved role in neuronal cell-type specification and mesodermal development. Dev Genes Evol. 2010;220(7-8):221–234. [PMC free article] [PubMed]
24. Santagata S, Resh C, Hejnol A, Martindale MQ, Passamaneck YJ. Development of the larval anterior neurogenic domains of Terebratalia transversa (Brachiopoda) provides insights into the diversification of larval apical organs and the spiralian nervous system. Evodevo. 2012;3:3. [PMC free article] [PubMed]
25. Nässel DR, Winther AME. Drosophila neuropeptides in regulation of physiology and behavior. Prog Neurobiol. 2010;92(1):42–104. [PubMed]
26. Schoofs L, Holman GM, Hayes TK, Nachman RJ, De Loof A. Isolation, identification and synthesis of locustamyoinhibiting peptide (LOM-MIP), a novel biologically active neuropeptide from Locusta migratoria. Regul Pept. 1991;36(1):111–119. [PubMed]
27. Schoofs L, Veelaert D, Broeck JV, De Loof A. Immunocytochemical distribution of locustamyoinhibiting peptide (Lom-MIP) in the nervous system of Locusta migratoria. Regul Pept. 1996;63(2-3):171–179. [PubMed]
28. Lorenz MW, Kellner R, Hoffmann KH. A family of neuropeptides that inhibit juvenile hormone biosynthesis in the cricket, Gryllus bimaculatus. J Biol Chem. 1995;270(36):21103–21108. [PubMed]
29. Hua YJ, et al. Identification of a prothoracicostatic peptide in the larval brain of the silkworm, Bombyx mori. J Biol Chem. 1999;274(44):31169–31173. [PubMed]
30. Williamson M, Lenz C, Winther AM, Nässel DR, Grimmelikhuijzen CJ. Molecular cloning, genomic organization, and expression of a B-type (cricket-type) allatostatin preprohormone from Drosophila melanogaster. Biochem Biophys Res Commun. 2001;281(2):544–550. [PubMed]
31. Yamanaka N, et al. Bombyx prothoracicostatic peptides activate the sex peptide receptor to regulate ecdysteroid biosynthesis. Proc Natl Acad Sci USA. 2010;107(5):2060–2065. [PMC free article] [PubMed]
32. Kim Y-J, et al. MIPs are ancestral ligands for the sex peptide receptor. Proc Natl Acad Sci USA. 2010;107(14):6520–6525. [PMC free article] [PubMed]
33. Liu F, Baggerman G, Schoofs L, Wets G. The construction of a bioactive peptide database in Metazoa. J Proteome Res. 2008;7(9):4119–4131. [PubMed]
34. Fischer A, Dorresteijn A. The polychaete Platynereis dumerilii (Annelida): A laboratory animal with spiralian cleavage, lifelong segment proliferation and a mixed benthic/pelagic life cycle. Bioessays. 2004;26(3):314–325. [PubMed]
35. Fischer AH, Henrich T, Arendt D. The normal development of Platynereis dumerilii (Nereididae, Annelida) Front Zool. 2010;7:31. [PMC free article] [PubMed]
36. Struck TH, et al. Phylogenomic analyses unravel annelid evolution. Nature. 2011;471(7336):95–98. [PubMed]
37. Veenstra JA. Neuropeptide evolution: Neurohormones and neuropeptides predicted from the genomes of Capitella teleta and Helobdella robusta. Gen Comp Endocrinol. 2011;171(2):160–175. [PubMed]
38. Tomer R, Denes AS, Tessmar-Raible K, Arendt D. Profiling by image registration reveals common origin of annelid mushroom bodies and vertebrate pallium. Cell. 2010;142(5):800–809. [PubMed]
39. Asadulina A, Panzera A, Veraszto C, Liebig C, Jékely G. Whole-body gene expression pattern registration in Platynereis larvae. EvoDevo. 2012;3:27. [PMC free article] [PubMed]
40. Park D, et al. The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol. 2008;28(1):410–421. [PMC free article] [PubMed]
41. Hamanaka Y, et al. Transcriptional orchestration of the regulated secretory pathway in neurons by the bHLH protein DIMM. Curr Biol. 2010;20(1):9–18. [PMC free article] [PubMed]
42. Acampora D, et al. Progressive impairment of developing neuroendocrine cell lineages in the hypothalamus of mice lacking the Orthopedia gene. Genes Dev. 1999;13(21):2787–2800. [PMC free article] [PubMed]
43. Perkins LA, Hedgecock EM, Thomson JN, Culotti JG. Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol. 1986;117(2):456–487. [PubMed]
44. Purschke G. Sense organs in polychaetes (Annelida) Hydrobiologia. 2005;535:53–78.
45. Jékely G, et al. Mechanism of phototaxis in marine zooplankton. Nature. 2008;456(7220):395–399. [PubMed]
46. Baubet V, et al. Chimeric green fluorescent protein-aequorin as bioluminescent Ca2+ reporters at the single-cell level. Proc Natl Acad Sci USA. 2000;97(13):7260–7265. [PMC free article] [PubMed]
47. Tunaru S, Lättig J, Kero J, Krause G, Offermanns S. Characterization of determinants of ligand binding to the nicotinic acid receptor GPR109A (HM74A/PUMA-G) Mol Pharmacol. 2005;68(5):1271–1280. [PubMed]
48. Gilbert SF, Epel D. Ecological Developmental Biology. Sunderland, MA: Sinauer; 2009.
49. Kim Y-J, Zitňan D, Galizia CG, Cho K-H, Adams ME. A command chemical triggers an innate behavior by sequential activation of multiple peptidergic ensembles. Curr Biol. 2006;16(14):1395–1407. [PubMed]
50. Moroz LL, et al. Neuronal transcriptome of Aplysia: Neuronal compartments and circuitry. Cell. 2006;127(7):1453–1467. [PMC free article] [PubMed]
51. Veenstra JA. Neurohormones and neuropeptides encoded by the genome of Lottia gigantea, with reference to other mollusks and insects. Gen Comp Endocrinol. 2010;167(1):86–103. [PubMed]
52. Wirmer A, Bradler S, Heinrich R. Homology of insect corpora allata and vertebrate adenohypophysis? Arthropod Struct Dev. 2012;41(5):409–417. [PubMed]
53. Leitz T, Morand K, Mann M. Metamorphosin A: A novel peptide controlling development of the lower metazoan Hydractinia echinata (Coelenterata, Hydrozoa) Dev Biol. 1994;163(2):440–446. [PubMed]
54. Gajewski M, Leitz T, Schloßherr J, Plickert G. LWamides from Cnidaria constitute a novel family of neuropeptides with morphogenetic activity. Rouxs Arch Dev Biol. 1996;205:232–242.
55. Erwin PM, Szmant AM. Settlement induction of Acropora palmata planulae by a GLW-amide neuropeptide. Coral Reefs. 2010;29:929–939.
56. Piraino S, et al. Complex neural architecture in the diploblastic larva of Clava multicornis (Hydrozoa, Cnidaria) J Comp Neurol. 2011;519(10):1931–1951. [PubMed]
57. Sinigaglia C, Busengdal H, Leclère L, Technau U, Rentzsch F. The bilaterian head patterning gene six3/6 controls aboral domain development in a cnidarian. PLoS Biol. 2013;11(2):e1001488. [PMC free article] [PubMed]
58. Grigoriev IV, et al. The genome portal of the Department of Energy Joint Genome Institute. Nucleic Acids Res. 2012;40(database issue):D26–D32. [PMC free article] [PubMed]
59. Hauenschild C, Fischer A. Platynereis Dumerilii. Mikroskopische Anatomie, Fortpflanzung, Entwicklung. Stuttgart: Gustav Fischer; 1969.
60. Conzelmann M, Jékely G. Antibodies against conserved amidated neuropeptide epitopes enrich the comparative neurobiology toolbox. Evodevo. 2012;3(1):23. [PMC free article] [PubMed]
61. Cardona A, et al. An integrated micro- and macroarchitectural analysis of the Drosophila brain by computer-assisted serial section electron microscopy. PLoS Biol. 2010;8(10):8. [PMC free article] [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...