Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Cell Rep. Author manuscript; available in PMC Sep 28, 2012.
Published in final edited form as:
PMCID: PMC3460375
NIHMSID: NIHMS395528

Mosaic mutant Analysis with Spatial and Temporal control of Recombination (MASTR): a new technique for determining the fate of mutant cells using conditional floxed alleles in mice

SUMMARY

Mosaic mutant analysis, the study of cellular defects in scattered mutant cells in a wild type environment, is a powerful approach for identifying critical functions of genes and has been applied extensively to invertebrate model organisms. A novel and highly versatile technique was developed in mouse, Mosaic mutant Analysis with Spatial and Temporal control of Recombination (MASTR), that utilizes the increasing number of floxed alleles and simultaneously combines conditional gene mutagenesis and cell marking for fate analysis. A targeted allele (R26MASTR) was engineered that expresses a GFPcre fusion protein following FLP-mediated recombination that serves the dual function of deleting floxed alleles and marking mutant cells with GFP. Within 24 hr of tamoxifen administration to R26MASTR mice carrying a new inducible FlpoER transgene and a floxed allele nearly all GFP-expressing cells have a mutant allele. The fate of single cells lacking FGF8 or SHH signaling in the developing hindbrain was analyzed using MASTR and revealed there is only a short time window when neural progenitors require FGFR1 for viability, and that granule cell precursors differentiate rapidly when SMO is lost. MASTR is a powerful tool that provides cell type specific (spatial) and temporal marking of mosaic mutant cells that is broadly applicable to developmental, cancer and adult stem cell studies.

Keywords: conditional mutagenesis, mouse genetics, conditional FLP recombination, FGF8, SHH

INTRODUCTION

In order to study the full repertoire of in vivo functions of a gene and to effectively model certain human diseases, it is necessary to generate tissue-specific conditional mutants at defined times during development, disease progression or homeostasis. Conditional mutagenesis in mouse can circumvent the lethality caused by germline null mutations, and allow the primary function of a gene to be determined in a specific organ or cell type without potential confounding secondary effects in other tissues. Furthermore, since many genes play multiple sequential roles in organ development, temporal control of conditional mutagenesis is a means to determine each distinct gene requirement. Although the introduction of site-specific recombinases and their target sequences into the mouse genome has allowed for conditional mutagenesis, there remain a number of limitations with the existing technology.

Mosaic mutant analysis is a powerful innovation applied to studies in model organisms that allows the behaviors of individual mutant cells to be analyzed in a wild type (WT) cellular environment, and distinguishes the cell autonomous functions of genes. In Drosophila, the elegant MARCM approach (Mosaic Analysis with a Repressible Cell Marker) combined with mutant alleles has revolutionized studies of cellular gene function by allowing mutant cells to be induced and marked in specific tissues at a defined time point using the FLP site-specific recombinase (Lee et al., 2000). A similar approach has been engineered in mice (MADM; Mosaic Analysis with Double Markers), and involves rare inter-chromosomal recombination events induced by CRE recombinase that produce a small number of cells marked with GFP (Zong et al., 2005). If a null allele resides on the same chromosome as the engineered reporter components of the MADM system, then mosaic mutant studies can be performed (Muzumdar et al., 2007). However, the most widely used method for conditional mutagenesis in mice involves combining a “floxed” allele in which a critical region of a gene is flanked by two loxP sites, the target of CRE, and a transgene expressing CRE in a specific organ or cell type. In order to knockout a gene at a particular time point, inducible forms of CRE have been developed, such as CreERT2 that is active for ~48 hr following tamoxifen (Tm) administration (Feil et al., 1997). However, a frequent problem faced in interpreting the phenotypes produced through conditional mutagenesis approaches, especially with CreER alleles, is that not all cells in a given tissue undergo recombination, and the mosaic mutant cells are often indistinguishable from WT cells. A CRE recombination dependent reporter allele can be included along with the conditional allele, however, the approach is not applicable to Cre lines with transient expression or for temporal conditional mutagenesis with CreER since there is a poor correlation between reporter expression and mutation. Depending on the recombination efficiency at each conditional loxP locus, either the reporter or floxed gene of interest will recombine more frequently, resulting in a large number of marked cells that are WT (false positives), or unmarked mutant cells (false negatives), confounding interpretation of the mutant cellular phenotype. Thus, a new technique for mosaic mutant analysis would be of high impact to the mouse genetics field.

An ideal mosaic approach in mice would utilize the rapidly growing number of floxed conditional alleles. Indeed, floxed alleles for the majority of mouse genes will soon be available as a result of large-scale genomics efforts in several countries (Ringwald et al., 2011; Skarnes et al., 2011). The SLICK (single-neuron labeling with inducible cre-mediated knockout) approach was developed with this in mind, but is limited to differentiated neurons that have high level and sustained Thy1 transgene expression (Heimer-McGinn and Young, 2011). Although this approach could be extended to other organs, tissue specific promoters that continue to express CreER and YFP in the mutant cells of interest after recombination will be difficult to identify. Expression of both CRE and GFP using viral vectors or electroporation has been exploited for mosaic mutant analysis, but the approach is extremely limited to accessible organs and particular stages of development. We have addressed these deficiencies in conditional mouse mosaic mutant analysis by developing a new method for sequentially marking and mutating any cell harboring a floxed gene at any time during development or in the adult.

RESULTS

Mosaic mutant Analysis with Spatial and Temporal control of Recombination (MASTR) Approach

In order to develop a highly versatile method for mosaic mutant analysis in mouse, we reasoned that the method should utilize the extensive resource of floxed genes, and incorporate tissue-specific and temporal control over mutagenesis as well as reliable detection of mutant cells. Given the proven effectiveness of fluorescent proteins, we developed an approach involving obligate sequential marking and mutation of mosaic cells. In the technique, FLP-mediated site specific recombination leads to sustained expression of a protein fusion between GFP and CRE (referred to as GFPcre), which leads to both rapid and efficient recombination of any floxed gene in a cell and results in permanent visualization of the mutant cells based on GFP. We term our new approach, Mosaic mutant Analysis with Spatial and Temporal control of Recombination, or MASTR (Fig. 1A,B).

Figure 1
Mosaic mutant Analysis with Spatial and Temporal control of Recombination (MASTR) strategy. (A) Schematic showing MASTR allele. (B) Schematic of genetic events leading to temporally controlled marking of cells with GFP and mutating an endogenous floxed ...

Using gene targeting, we generated a ROSA26 allele (R26MASTR; Supplementary Fig. 1A) in which a neo gene cassette including a strong polyadenylation sequence from the Pgk gene (acting as a STOP of transcription/translation) flanked by frt sites precedes a cDNA encoding GFPcre (Le et al., 1999) and an SV40 polyadenylation sequence (Bai and Joyner, 2001). Since the R26 allele is expressed ubiquitously, when the R26MASTR allele undergoes FLP-mediated recombination of the frt flanked neo cassette, this results in continuous GFPcre expression in the cell and all its descendents. The MASTR approach entails two additional genetic alleles: an inducible Flp transgene or knockin, and a floxed gene. When R26MASTR and an inducible Flp allele are combined with any floxed gene, then following administration of the inducing agent GFPcre will be expressed from the recombined R26MASTR allele and result in rapid deletion of the floxed gene creating mosaic mutant cells (Fig. 1B). Importantly, the mutant cells and their progeny can be identified by continuous GFP expression from the R26 allele.

We first tested whether the R26MASTR allele undergoes efficient FLP-mediated recombination and expresses GFP robustly, by using an existing FlpER line (CAG-FlpeERT2) active in the embryo (Hunter et al., 2005). Indeed, CAG-FlpeER/+; R26MASTR/+ embryos treated with a high dose of Tm (225 μg per gm) at embryonic day 9.5 (e9.5) and analyzed at e13.5 by immunohistochemical (IHC) staining for GFP protein showed scattered GFP+ cells throughout the embryo (Fig. 1C and data not shown). Analysis of adult brain tissue at high power magnification demonstrated that as expected (Le et al., 1999) the majority of GFP protein was localized to the nucleus and a low level of GFP expression was detected in the cell body and processes (axons of neurons; Fig. 1D). Furthermore, native GFP fluorescence could be visualized in fixed tissue sections without IHC (Fig. 1E), indicating GFP expressed from the recombined R26MASTR allele can be used for live imaging analysis of mutant cell behaviors.

Validation of MASTR Technique

Two important criteria must be met for the MASTR approach to be effective for mosaic mutant analysis. First, the R26MASTR allele must have a very low level of illegitimate GFPcre expression in the absence of FLP activity. Second, nearly all GFP+ cells must undergo CRE-mediated deletion of an accompanying floxed gene. To validate that our R26MASTR allele meets these criteria, the R26lox-STOP-lox-lacZ (R26lox-lacZ) reporter allele (Soriano, 1999) was used to mimic a floxed mutant gene (Fig. 2A). As predicted, cells expressing lacZ (beta-galactosidase (βGal) activity) were detected throughout the brain of CAG-FlpeER/+; R26MASTR/lox-lacZ mice following administration of a high dose of Tm at either embryonic or adult stages (Fig. 2B, and data not shown).

Figure 2
Validation of the MASTR approach. (A) Schematic showing strategy used to validate the approach. Blue dots represent βGal protein. (B) Sagittal sections of adult R26MASTR/lox-lacZ brain show βGal+ cells throughout the brain when TM is administered ...

To determine whether functional GFPcre is spuriously expressed in somatic cells from the R26MASTR allele in the absence of FLP-mediated recombination, we examined βGal activity in sections of R26MASTR/lox-lacZ adult mice (n=5) generated by breeding mice carrying the R26MASTR allele with those carrying the R26lox-lacZ reporter allele. Significantly, only rare cells were βGal+ in adult mice (0 to 60 cells per sagittal section of an entire brain; n=138 sections from 5 mice; Fig. 2C,D). The βGal+ cells in a section were often seen in clusters, likely reflecting clonal marking of a common ancestor. As expected, in R26lox-lacZ/+ control mice no βGal activity was detected (data not shown). A smaller number of βGal+ cells were detected in sections of whole R26MASTR/lox-lacZ embryos (e9.5–e13.5)(0–13 cells/section; n=9). Double IHC labeling for GFP and βGal protein in R26MASTR/lox-lacZ embryonic tissues uncovered that none of the βGal+ cells also expressed GFPcre (Fig. 2E). These results demonstrate that only the occasional cell transiently expresses GFPcre from the R26MASTR allele during embryonic development or in the adult. Importantly, since GFPcre is only transiently expressed, any rare mutant cells resulting from deletion of an accompanying floxed gene at an undetermined time point will not express GFP and therefore will not be considered as mutant cells. Such mutant cells are false negatives, and importantly their rate of production is negligible.

We next tested whether the R26MASTR allele expresses GFPcre in the germline, by breeding R26MASTR/lox-lacZ mice with WT mice, and detecting βGal+ cells in ~e10.5 embryos. Surprisingly, all R26+/lox-lacZ embryos generated from R26MASTR/lox-lacZ males showed βGal activity in all cells of the embryo, whereas all R26+/lox-lacZ embryos generated from R26MASTR/lox-lacZ females had no βGal+ cells (data not shown). Since the R26MASTR allele in R26MASTR/+ embryos from R26MASTR/lox-lacZ males had not undergone spontaneous recombination (based on PCR genotyping and staining for GFP; data not shown), the R26MASTR allele must spuriously express GFPcre in the male germline. Indeed, testes sections from R26MASTR/lox-lacZ males had βGal+ cells in the germ cell lineage (Supplementary Fig. 2A,B). Importantly, when R26MASTR/+ males were crossed with R26+/lox-lacZ females, only rare βGal+ cells were seen in R26MASTR/lox-lacZ mice (Fig. 2C,D). Thus, although GFPcre is expressed spuriously in the male germ cell lineage from the R26MASTR allele in the absence of FLP activity, GFPcre protein is not transmitted to the fertilized egg.

To test the second critical component of the MASTR approach, whether a high percentage of GFP+ cells carry a deleted (mutant) floxed allele, we assessed the degree to which cells in CAG-FlpeER/+; R26MASTR/lox-lacZ mice co-express GFP and βGal on successive days after Tm administration. In CAG-FlpeER/+; R26MASTR/lox-lacZ embryos administered Tm (225 μg per gm) at e13.5, efficient mosaic marking and mutation of cells (GFP and βGal double staining) was achieved within 24 hours (90% of GFP+ cells expressed βGal; n=1435 cells; n=4 embryos), with a similar percentage of double marked cells at 48 hr (n=855 cells; n=3 embryos), and an even higher (~97%) by 72 hours (n=903 cells; n=3 embryos)(Fig. 2F). In a separate experiment in which embryos were administered Tm at e12.5, 98% of GFP+ cells expressed βGal after 72 hr (n=561 cells; n=2 embryos)(Supplementary Fig. 2C–E). To determine whether all GFP+ cells eventually have detectable βGal activity, P21 mice were administered Tm on three consecutive days and then analyzed 3–5 weeks later. Similar to our analysis of embryos at 72 hr post Tm, ~98% of adult cells co-expressed GFP and βGal (n=1,083 cells from 3 mice). Importantly, these experiments demonstrate that mosaic mutant cells can be identified within 24hr based on GFP expression with near complete concordance by 72hr using the MASTR approach.

MASTR Approach Reveals New Insights into FGF8 and SHH Signaling

We next used our MASTR approach to gain insight into two well studied signaling pathways, fibroblast growth factor (FGF) and sonic hedgehog (SHH). First we studied the cell autonomous requirement for FGF8 signaling in small cohorts of cells in the developing dorsal midbrain and cerebellum. FGF receptor 1 (FGFR1) was previously shown to be required downstream of the isthmic organizer molecule FGF8 for cell survival, based on conditional deletion of FgfR1 or Fgf8 in all cells of the midbrain and cerebellum at e8.5 using an En1Cre allele (Chi et al., 2003; Trokovic et al., 2003). We recently found, however, that when Fgf8 is conditionally ablated a day later using an En2CreER allele, cell survival is not significantly compromised in the midbrain and cerebellum (Sato and Joyner, 2009), suggesting that FGF8 is only transiently required for cell survival. Since Fgf8 or FgfR1 were removed in all cells of the region at e8.5 using En1Cre, whereas using the En2CreER allele Fgf8 was ablated in only ~80% of cells at ~E9.5, it is possible that the cell survival seen in the latter study is due to rescue by low level FGF8 signaling provided by the WT cells that remained.

In order to distinguish between the two possibilities, we utilized the MASTR approach to test whether FgfR1 is required for cell survival in individual cerebellum and dorsal midbrain cells near the isthmus. Indeed, by analyzing CAG-FlpeER; R26MASTR/+; FgfR1−/lox embryos treated with Tm (200 μg per gm) at e8.5 or e9.5, we found that FGF8 signaling through FGFR1 is required for survival of individual cells only within a narrow time window. Deletion of FgfR1 by administering Tm at e8.5 resulted in a >50% reduction in GFP+ marked cells within the dorsal posterior midbrain and cerebellum at e11.5 compared to CAG-FlpeER; R26MASTR/+; FgfR1+/lox controls using the ventral posterior hindbrain to normalize for differences in recombination efficiency (n=3 controls and 3 mosaic mutants; Fig. 3A,A′,B,B′,E,F). In contrast, when Tm was administered at e9.5, no significant decrease in cell survival of GFP+ marked FgfR1 mutant cells was observed three days later (n=3 controls and 3 mosaic mutants; Fig. 3C,C′,D,D′,F). Consistent with the results seen at e11.5, few marked cells were present in the posterior midbrain or cerebellum at e17.5 when Tm was administered at e8.5 (n=2)(data not shown). Thus, using MASTR we demonstrate that FGF8 signaling through FGFR1 is only transiently required for cell autonomous viability in the developing posterior midbrain and cerebellum.

Figure 3
Deletion of FgfR1 only when FGF8 is first expressed results in loss of cells near the isthmus organizer (dorsal posterior midbrain and cerebellum). (A–D and A′–D′) Midline sagittal sections of the dorsal midbrain/hindbrain ...

We next asked whether SHH signaling is required continuously in proliferating granule cells of the postnatal cerebellum. SHH is secreted by Purkinje cells of the cerebellum from e17.5 onwards and signals to granule cell precursors (gcps) and Bergmann glia (Fuccillo et al., 2006). Previous studies found that ablation of the SHH receptor SMO in all cells of the embryonic cerebellum using a Nestin-Cre transgene resulted in a dramatic decrease in the number of granule neurons (Corrales et al., 2006). Since gain-of-function studies have shown that SHH stimulates gcp proliferation, it has been assumed that the defect in Nestin-Cre; Smolox/− mice is due to a cell autonomous effect in gcps, possibly leading to loss of proliferation, cell death or premature differentiation. In order to test a cell autonomous function of SMO in gcps, we used MASTR to ablate Smo and examined the phenotype in the granule cell lineage. When Tm (150 μg per gm) was administered to CAG-FlpeER; R26MASTR/+; Smo−/lox mice at P1 or P2 and the cerebellum analyzed at P8, a clear defect in gcps was seen (Fig. 4A–E). Whereas in control mice (CAG-FlpeER; R26MASTR/+; Smo+/lox or CAG-FlpeER; R26MASTR/+; Smo−/+) many GFP+ gcps were present in the proliferating outer layer of the external granule cell layer (43 GFP+ cells in lobule X per section; Fig. 4A,B,F), in CAG-FlpeER; R26MASTR/+; Smo−/lox mutant cerebella most sections had no GFP+ gcps. Interestingly, GFP+ mutant cells were present but expressed p27, a marker of postmitotic granule neurons (Fig. 4C–F). Thus, SHH is required cell autonomously in gcps to maintain them in a proliferating and undifferentiated state. Taken together, our two studies of the cell autonomous requirements for FGFR1 and SMO demonstrate the utility of the MASTR approach for uncovering cell behaviors altered when key signaling pathways are disrupted.

Figure 4
Deletion of Smo in granule cell precursors of the cerebellum results in premature differentiation. (A–E) Midline sagittal sections of cerebellum showing lobule X in control, CAG-FlpeER; R26MASTR/+; Smo+/lox (A) or CAG-FlpeER; R26MASTR/+; Smo+/ ...

Generation of an Efficient Universal FLPo Inducible Mouse Line and Lineage Specific FLPoER Transgenic Mice

We sought to develop a line of mice in which FLP can be efficiently activated in all tissues, since the efficiency of recombination of the CAG-FlpeER transgenic line was found to be low in most adult tissues and not effective in the spleen or skin (Fig. 5, Supplementary Table 1). Given the recent demonstration that a FLPe construct optimized for translation in mammalian cells (termed FLPo) has a higher recombination efficiency than FLPe in cells and in mice (Kranz et al., 2010; Raymond and Soriano, 2007, 2010), we generated two constructs in which FLPo and ERT2 were joined by either the linker sequence in FLPeERT2 (FlpoER) which was found to be effective for Flpe (Hunter et al., 2005; Logie et al., 1998) or the linker in CreERT2 (FlpoER1). We then generated universal inducible Flpo mouse lines by targeting each cDNA to the R26 allele in ES cells (Fig. 5A and Supplementary Fig. 1B). To ensure high expression levels, the constructs were placed downstream of a CAG promoter and enhancer (Zong et al., 2005).

Figure 5
Universal FlpoER inducible lines of R26 knockin mice reveal the importance of the linker sequence between FLP and ER. (A) Schematic showing R26FlpoER (or R26FlpoER1) targeted allele. Sections of the tissues indicated from ~P35 R26FlpoER/frt-nlacZ derived ...

The efficiency of recombination of the R26FlpoER and R26FlpoER1 alleles was compared to each other and to CAG-FlpeER at e9.5, P1 and in adult organs using a R26frt-STOP-frt-nlacZ nuclear βGal reporter allele (R26frt-nlacZ; derived from RC::Fela (Jensen et al., 2008)) or GFP expression from the recombined R26MASTR allele (data not shown). FLP activity was induced by Tm in all organs using the R26 alleles, and importantly was consistent between animals within each stage and organ, although the extent of recombination was specific to each organ and stage of induction (Fig. 5B–Q, Supplementary Fig. 4 and Table 1). Most strikingly, the R26FlpoER line consistently showed higher recombination in embryonic and adult tissues than the R26FlpoER1 line, and significantly only very rare recombination in the absence of Tm (similar to the R26MASTR allele alone). Furthermore, the recombination efficiency was higher with the R26FlpoER allele than the CAG-FlpeER transgene, with the exception of some regions of the brain (e.g. cerebellum) using the same reporter and dose of Tm (Fig. 5B–I, R–Y, Supplementary Fig. 3 and Table 1). Thus, our new ubiquitous inducible R26FlpoER line with the FLPeERT2 linker sequence combined with R26MASTR can be used for mosaic mutant analysis of floxed genes expressed in any tissue at any time during development or in the adult.

Since for many mosaic mutant studies in mice it will be optimal to mark and mutate cells in specific cell lineages or organs, we generated neural progenitor specific transgenic lines expressing FlpoER or FlpoER1 from a Nestin transgene construct (Fig. 6A)(Mignone et al., 2004). Consistent with our findings targeting the R26 allele, the FLPoER protein resulted in higher recombination levels in embryonic and adult brains than FLPoER1 (Fig. 6B–G). Importantly, recombination was specific to neural progenitors in the embryo and adult neural stem cells in the forebrain.

Figure 6
Generation of neural specific mouse lines expressing inducible Flpo. (A) Schematic diagram of transgene construct containing FlpoER (or FlpoER1) and Nestin gene regulatory elements used to make transgenic lines of mice. Sagittal brain sections of e13.5 ...

DISCUSSION

To provide a versatile mosaic mutant analysis approach in mouse and to overcome major limitations of current conditional knockout approaches, we utilized the tremendous resource of floxed conditional alleles (Collins et al., 2007; Ringwald et al., 2011) and engineered a universally applicable mouse knockin line (R26MASTR) for controlled mosaic mutant analysis. In our MASTR approach, floxed genes are conditionally mutated in mosaic cells and simultaneously marked with GFP under both temporal and tissue or cell type-specific (spatial) control. An essential second component of the system is mouse lines expressing an inducible FLP recombinase to provide the specificity of CRE-mediated recombination of floxed alleles. Cells expressing active FLP rapidly express a GFPcre fusion protein due to deletion of an frt flanked STOP sequence upstream of GFPcre within the R26MASTR allele. Any floxed gene in the cell is subsequently rapidly deleted (>90% of cells by 24hr and ~97% by 72 hr). Specific tissues are targeted for gene deletion by choosing an appropriate promoter and temporal control over FLP activity and production of mosaics is provided by using an inducible FLP. Since we found FLPeERT2 did not induce efficient recombination in mice (unpublished observations based on a R26 knockin line and transgenic mice), we constructed and compared the efficiency of two inducible proteins based on a FLPo backbone. Interestingly, we found that the linker sequence between FLPo and ERT2 impacts on the efficiency of recombination, and that the linker in FLPeERT2 (Hunter et al., 2005; Logie et al., 1998) is optimized for regulating FLP proteins, compared to the linker in CreER (Feil et al., 1997). Moreover, our R26FlpoER allele using the FLPeERT2 linker can be used in combination with R26MASTR for mosaic mutant studies in any tissue, and at any time during development or in the adult.

Using the R26MASTR allele and a R26lox-lacZ allele to mimic a floxed gene, we found that less than 3% of GFP+ cells are WT (βGal−) 72 hr after Tm administration, and importantly that false negatives (GFP-/βGal+) are extremely rare (~1 in a million cells since the mouse brain contains ~100 million cells (Herculano-Houzel and Lent, 2005). Some of the observed rare false positive cells could be true positives falsely characterized as WT because of limitations in IHC sensitivity. Alternatively, some could be WT cells that are resistant to recombination by the continuously expressed GFPcre, possibly due to the chromatin structure of the floxed allele. This is an inherent problem using any floxed allele, and the degree of resistance to recombination will have to be determined empirically for every allele and each genetic background. Nevertheless, our mosaic deletion of both FgfR1 and Smo functionally validate the MASTR technique, as well as an additional gene that we used the MASTR approach for. In order to induce constitutive canonical WNT signaling in the spinal cord at ~e7.5 we conditionally deleted exon 3 of the beta catenin gene (Harada et al., 1999) and found that 98% of GFP+ cells at e10.5 mis-expressed MSX1/2 in the ventral spinal cord compared to normal embryos in which only rare cells expressed MSX1/2 (unpublished results). Thus, MASTR will likely be applicable to the vast majority of conditional alleles. One possible drawback to the MASTR approach is that CRE might be toxic to some cells (Legue and Joyner, 2010), despite the relatively low expression level from the R26 locus. Importantly, we did not observe a high level of cell death in midgestation control embryos (CAG-FlpeER; R26MASTR/+; FgfR1+/flox) and mice expressing GFPcre in most cells appear normal (Supplementary Fig. 5).

Using the MASTR approach to study FGF signaling in the developing brain, we uncovered that FGF8 signaling through FGFR1 is only transiently required for cell viability in the dorsal midbrain and cerebellum. Our mosaic mutant results also provide further support that FGFR1 is the primary receptor for FGF8 functioning near the isthmus (Saarimaki-Vire et al., 2007), and demonstrates the exquisite sensitivity of individual cells to a reduction in FGF8 signaling in a time-dependent manner. Our results shed new light on interpretation of a previous study of FgfR1−/lox; En1Cre conditional mutant embryos in which cell death was observed near the isthmus within a day of FgfR1 deletion at e8.5 (Trokovic et al., 2003), and suggests that later deletion in the midbrain and cerebellum would not lead to cell death. Consistent with this, FGF8 has later roles in regulating expression of key genes involved in midbrain and cerebellum development (Sato and Joyner, 2009). The cellular consequences of altering FGF8 regulated genes can now be studied using the MASTR approach. Furthermore, these functional studies demonstrate the power of the MASTR technique in assessing the critical nature of the timing of gene action and the cell autonomous role of genes within the mouse.

The MASTR approach will not only be a powerful approach for determining the function of genes based on mutant cell behaviors during development and in adult stem cells, but also can be used to model mosaic human diseases. One of the most prevalent examples of mosaic disease is sporadic cancer. While the importance of modeling sporadic cancers with a mosaic mutant approach has been demonstrated using a line of mice in which the MADM allele is on chromosome 11 which harbors a number of known tumor suppressor genes (Liu et al., 2011; Muzumdar et al., 2007), with the MASTR approach any cancer can be modeled using floxed alleles of the key tumor suppressors and/or oncogenes. Furthermore, since the tumor cells are GFP labeled using MASTR, a pure population of tumor cells can be isolated for further biochemical and genomic analysis.

In summary, we have developed and validated a new method for mosaic mutant analysis in mice that combines sequential expression of a new inducible FLPoER protein with sustained conditional expression of GFPcre and deletion of floxed genes. Moreover, we have demonstrated the importance of controlling the time and cell type of mutagenesis in mosaic studies. The R26MASTR allele can also be used to convert the growing number of tissue and cell type specific Flp lines of mice into Cre lines, with the added advantage that mutant cells are marked with GFP (Supplementary Fig. 5). Finally, new versions of the R26MASTR allele can now be designed that co-express CRE and any marker protein, for example using the viral 2A peptide (Trichas et al., 2008). As additional inducible site-specific recombinases are generated, such as using DRE (Anastassiadis et al., 2009), they could be used in combination with FLPoER to induce GFPcre expression in a more defined cell population using intersectional genetics (Dymecki et al., 2010). Thus, we have described the first critical step in a far ranging new approach to mutant mosaic analysis in mouse.

EXPERIMENTAL PROCEDURES

Construction of Mice Carrying a R26MASTR Allele

All experiments were conducted according to protocols approved by the Memorial Sloan-Kettering Cancer Center Animal Care and Use Committee. A R26MASTR targeting vector was constructed that consists of a 1kb 5′ arm of homology from the first intron of the R26 allele ending at an XbaI site (Soriano, 1999), followed by an SV40 splice acceptor (Zambrowicz et al., 1997), frt flanked Pgk-neo cassette with a strong Pgk-derived polyA sequence, eGFPcre cDNA (from pBS594 (Le et al., 1999)), three copies of a 250bp SV40 polyA sequence (Bai and Joyner, 2001), and adjacent 4kb 3′ arm of homology from the first intron of the R26 allele (Soriano, 1999). The vector was then linearized with SalI and targeted into the R26 locus in mouse 129SvEv Tac W4 ES cells (Auerbach et al., 2000) and chimeras produced by blastocyst injection using standard methods (Matise et al., 2005; Papaioannou and Johnson, 2005). Germ line transmitting chimeras were bred with 129SvEv Tac mice and sperm from the resulting mice frozen. For all studies reported, chimeras were bred with C57bl/6 mice and then F1 mice were bred with outbred Swiss Webster (SW) mice or mice carrying reporter alleles that had been bred with SW mice.

Production of R26frt-nlacZ Line

The R26frt-nlacZ line (previously described as RC::Fa in (Jensen et al., 2008)) was generated by mating R26frt-STOP-frt-lox-GFP-lox-nlacZ mice (RC::Fela (Jensen et al., 2008)) with a CAG-Cre deleter line (Sakai and Miyazaki, 1997) to remove a loxP flanked Gfp cassette, resulting in a reporter allele that expresses nuclear localized LACZ (nlacZ cDNA) following FLP-mediated recombination of an frt flanked neo STOP cassette.

Construction of FlpoER cDNAs

A cDNA construct encoding FLPoER1 was produced by fusing a DNA sequence encoding an optimized FLP obtained from Addgene (Raymond and Soriano, 2007) to the linker and ERT2 sequence in CreERT2 (bp 2082–2090)(Feil et al., 1997). FlpoER was produced by replacing the linker sequence in FlpoER1 (CTCGAGCCA) with the linker sequence (TGCGTACGCGGATCC) from FlpeER (Hunter et al., 2005; Logie et al., 1998).

Gene Targeting Strategy for Universal FlpoER and FlpoER1 Inducible Alleles in the R26 Locus

A cassette containing a loxP flanked Pgk-neo cassette was subcloned into the SwaI site of a plasmid (pCA(HZ2)) containing a CAG promoter sequence (Zong et al., 2005), and FlpoER or FlpoER1 was then cloned downstream of the CAG promoter sequence in a SmaI site. A targeting construct was then constructed using the R26 genomic fragments described above (Soriano, 1999) in order to target each vector into the XbaI site in the first intron. The vector was then linearized with SalI and the FlpoER construct was targeted into the R26 locus in mouse 129SvEv Tac W4 ES cells (Auerbach et al., 2000) and CY2.3 cells (gift of the Rockefeller Gene Targeting core) and the FlpoER1 construct was targeted into W4 ES cells. Chimeras were then produced by blastocyst injection using standard methods (Matise et al., 2005; Papaioannou and Johnson, 2005). Germ line transmitting chimeras were bred with 129SvEv Tac mice and sperm from the resulting mice frozen. For all studies reported, chimeras were bred with C57bl/6 mice and then F1 mice were bred with outbred Swiss Webster (SW) mice or mice carrying reporter alleles that had been bred with SW mice. R26FlpoER mice derived from W4 or CY2.3 ES cells gave similar recombination results in mice (compare Fig. 5 and Supplementary Fig. 4).

The recombination efficiency of FLPoER and FLPoER1 was compared in R26FlpoER/+ or R26FlpoER1/+ mice carrying Gfp or nlacZ conditional reporters (R26MASTR or R26frt-nlacZ) by analyzing GFP protein by IHC or βGal activity by X-gal analysis. e13.5 embryos were analyzed after treatment with Tm (125 μg per gm) at e9.5, or P6 mice treated with Tm (150 μg per gm) on P1, or adult mice treated with Tm (250 μg per gm) and brains analyzed 1 week later (n= at least 3 for each time point).

Construction of Nestin-FlpoER Transgenic Mice

A 2.3 kb SalI/SpeI FlpoER or FlpoER1 fragment was subcloned into the SalI/XbaI sites of a rat Nestin expression construct that contains promoter sequences and the second intron (Mignone et al., 2004). The FlpoER or FlpoER1 cDNA was inserted between the promoter and intron sequences, and followed by one copy of a 250bp SV40 polyA site. SmaI was used to release the Nestin-FlpoER-SV40 polyA sequences, which was used for pronuclear injections of fertilized oocytes.

Sixty-six animals born after injection of Nestin-FlpoER1 and fifty-two after injection of Nestin-FlpoER were screened by PCR using the primers 5′GCTTCCGCTGGGTCACTGTCGC3′ (corresponding to a sequence in the Nestin promoter gene) and 5′ ATCATCCAGCACAGGTAGGTCAGC3′ (corresponding to a sequence in the FlpoER cDNA). The expected fragment of 300 bp was detected in 11 Nestin-FlpoER1 founder (F0) and 10 Nestin-FlpoER F0 transgenic mice. 7 of the F0 Nestin-FlpoER1 and 5 of the Nestin-FlpoER mice transmitted the transgene to their F1 offspring. F1 males from each line were screened for transgene activity by mating with R26MASTR or R26frt-nlacZ females. Embryonic ages were determined as the time since the appearance of a copulative plug (noon of the first day was determined as e0.5). Tm was administered on e9.5, and embryos analyzed at e13.5 for GFP and βGal expression. GFP+ or βGal+ cells were detected in the developing nervous system of all the Nestin-FlpoER1 lines and 4/5 Nestin-FlpoER lines tested. Only 1 Nestin-FlpoER1 line showed a few GFP+ cells in the absence of Tm. Lines were further screened for expression in the adult brain by administering Tm on 2 or 3 consecutive days and analyzing brain sections 1 month later. GFP+ cells were detected in the ependymal cell layer of the subventricular zone of the fourth ventricle in all lines. The one Nestin-FlpoER and Nestin-FlpoER1 line that gave the highest amount of recombination in the presence of Tm and no recombination in the absence of Tm was chosen for detailed analysis. The efficiency of recombination of the Nestin-FlpoER1 transgene appeared to be similar to that of R26FlpoER when Tm (125 μg per gm) was administered at e9.5 (with variations in different regions of the brain), and the Nestin-FlpoER line gave much higher recombination in embryos.

Histology, Immunohistochemistry and X-Gal Staining

Tissue processing and X-gal analysis were performed as described on the Joyner web-site (http://www.mskcc.org/mskcc/html/77387.cfm). Frozen sections were prepared at a thickness of 12μm. Immunofluorescent histochemistry (IHC) was performed using standard staining procedures with the following primary antibodies: goat-anti-β-gal (1:1500; Biogenesis), rabbit-anti-GFP (1:1000; Invitrogen), rat-anti-GFP (1:1000; Nacalai Tesque), mouse-anti-p27/Kip1 (1:500; BD Biosciences), goat-anti-OTX2 (1:500; R&D Systems) and secondary antibodies: donkey anti-goat-Alexa 555, donkey anti-rabbit-Alexa 488, donkey-anti-rat-Alexa 488, and donkey-anti-goat-Alexa 555 (1:1000; Invitrogen).

Quantification and Statistics

To determine the number of cells that underwent recombination in the absence of Tm, the number of βGal+ cells on each of 138 entire sagittal brain sections from five adult R26MASTR/lox-lacZ mice was counted and then the results of each slide were binned into groups of 5 (0–5, 6–10, etc) and graphed (Fig. 2C). In order to determine the percentage of GFP+ cells that also carry a mutant floxed allele, we quantified the number of cells in CAG-FlpeER/+; R26MASTR/lox-lacZ mice that co-expressed GFP and βGal 24 hr, 48 hr and 72 hr days after Tm administration (225 μg per gm). 12μm sagittal sections of embryos at each stage (1 section/embryo, n=3–4 embryos per stage) were double stained for GFP and βGal protein and the number of single and double labeled cells counted in the midbrain and anterior hindbrain (855–1435 cells counted at each stage). The percentage of βGal+ cells that also expressed GFP was then calculated (Tm 24hr, 90%±1.7%, n=4; Tm 48hr, 92%±0.9%, n=3; Tm 72hr, 97%±1.9%, n=3)(Fig. 2F). Statistical analysis was performed using Microsoft Excel to calculate mean and standard deviation (mean±SD).

Quantification of GFP+ cells in mosaic mutant FgfR1lox (Trokovic et al., 2003) embryos was performed after IHC staining for GFP and OTX2 on 12μm frozen sections at e11.5 and e12.5 of control CAG-FlpeER; R26MASTR/+; FgfR1+/lox and mutant CAG-FlpeER; R26MASTR/+; FgfR1−/lox embryos 3 days after Tm administration, as shown in Fig. 3. Images were imported into Neurolucida software (MBF Biosciences) and quantified as follows. The quantified area included the OTX2- region within the dorsal hindbrain encompassing the cerebellum and the area within the dorsal posterior midbrain defined as a 100μm distance anterior from the dorsal midbrain-cerebellum boundary defined by the abrupt cutoff in OTX2 expression (see Fig. 3E). To control for recombination efficiency between embryos, GFP+ cells per μm2 in the dorsal midbrain and cerebellum were normalized to the number of GFP+ cells per μm2 in the ventral posterior hindbrain, a region that is not sensitive to FgfR1 loss (see Fig. 3E). The data is presented as the number of GFP+ cells per μm2 in the dorsal midbrain and cerebellum divided by the number of GFP+ cells per μm2 in the ventral hindbrain region and multiplied by 100. A minimum of 300 GFP+ cells were counted for each region for control and mutant embryos at e12.5 and a minimum of 100 GFP+ cells were counted for e11.5 embryos due to smaller area and lower recombination at this stage. Statistical analysis was performed using Apple Numbers software with mean and SD calculated (n=3 for control and mutant embryos at each time point) and p-values calculated using a Student’s unpaired t-test.

Quantification of GFP+ cells in the outer EGL of lobule X of the cerebellum of mosaic mutant Smolox (Long et al., 2001) embryos was performed after IHC staining for GFP and p27 on 12μm frozen sections (15 mutant sections and 6 control sections) at P8 in control mice, CAG-FlpeER; R26MASTR/+; Smo+/lox (n=1) or CAG-FlpeER; R26MASTR/+; Smo+/− (n=1), and mutants, CAG-FlpeER; R26MASTR/+; Smo−/lox (n=5), 6–7 days after Tm administration.

Highlights

  • A highly versatile new technique for mosaic mutant analysis in mouse was developed
  • Combines FLPoER and conditional expression of GFPcre with deletion of floxed genes
  • For studies of mutant cell behaviors during development and in adult stem cells
  • MASTR can be used to model sporadic human diseases and isolate mutant cells (GFP+)

Supplementary Material

01

Acknowledgments

We thank Daniel Stephen for technical assistance, Chingwen Yang of Rockefeller University ES cell core for supervising all gene targeting experiments, the Sloan-Kettering Institute Mouse Genetics core for generating chimeras, Susan Dymecki for providing a FlpeER cDNA and CAG-FlpeER and RC::Fela mouse lines, Philippe Soriano for providing R26 targeting constructs, David Ornitz for providing FgfR1lox mice and Andy McMahon for providing Smolox mice. We are grateful to Emilie Legué and Kat Hadjantonakis for insightful comments on the manuscript and Isaac Brownell for thoughtful discussions. This work was supported by grants from the NIH to ALJ (HD050767, CA128158) and to PR (K08NS66083) and from the Geoffrey Beene Cancer Research Fund.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Anastassiadis K, Fu J, Patsch C, Hu S, Weidlich S, Duerschke K, Buchholz F, Edenhofer F, Stewart AF. Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice. Dis Model Mech. 2009;2:508–515. [PubMed]
  • Auerbach W, Dunmore JH, Fairchild-Huntress V, Fang Q, Auerbach AB, Huszar D, Joyner AL. Establishment and chimera analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell lines. Biotechniques. 2000;29:1024–1028. 1030–1032. [PubMed]
  • Bai CB, Joyner AL. Gli1 can rescue the in vivo function of Gli2. Development. 2001;128:5161–5172. [PubMed]
  • Chi CL, Martinez S, Wurst W, Martin GR. The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development. 2003;130:2633–2644. [PubMed]
  • Collins FS, Rossant J, Wurst W. A mouse for all reasons. Cell. 2007;128:9–13. [PubMed]
  • Corrales JD, Blaess S, Mahoney EM, Joyner AL. The level of sonic hedgehog signaling regulates the complexity of cerebellar foliation. Development. 2006;133:1811–1821. [PubMed]
  • Dymecki SM, Ray RS, Kim JC. Mapping cell fate and function using recombinase-based intersectional strategies. Methods Enzymol. 2010;477:183–213. [PubMed]
  • Feil R, Wagner J, Metzger D, Chambon P. Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Biophys Res Commun. 1997;237:752–757. [PubMed]
  • Fuccillo M, Joyner AL, Fishell G. Morphogen to mitogen: the multiple roles of hedgehog signalling in vertebrate neural development. Nature reviews Neuroscience. 2006;7:772–783. [PubMed]
  • Harada N, Tamai Y, Ishikawa T, Sauer B, Takaku K, Oshima M, Taketo MM. Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 1999;18:5931–42. [PMC free article] [PubMed]
  • Heimer-McGinn V, Young P. Efficient inducible Pan-neuronal cre-mediated recombination in SLICK-H transgenic mice. Genesis. 2011;49:942–949. [PubMed]
  • Herculano-Houzel S, Lent R. Isotropic fractionator: a simple, rapid method for the quantification of total cell and neuron numbers in the brain. J Neurosci. 2005;25:2518–2521. [PubMed]
  • Hunter NL, Awatramani RB, Farley FW, Dymecki SM. Ligand-activated Flpe for temporally regulated gene modifications. Genesis. 2005;41:99–109. [PubMed]
  • Jensen P, Farago AF, Awatramani RB, Scott MM, Deneris ES, Dymecki SM. Redefining the serotonergic system by genetic lineage. Nat Neurosci. 2008;11:417–419. [PMC free article] [PubMed]
  • Kranz A, Fu J, Duerschke K, Weidlich S, Naumann R, Stewart AF, Anastassiadis K. An improved Flp deleter mouse in C57Bl/6 based on Flpo recombinase. Genesis. 2010;48:512–520. [PubMed]
  • Le Y, Miller JL, Sauer B. GFPcre fusion vectors with enhanced expression. Anal Biochem. 1999;270:334–336. [PubMed]
  • Lee T, Winter C, Marticke SS, Lee A, Luo L. Essential roles of Drosophila RhoA in the regulation of neuroblast proliferation and dendritic but not axonal morphogenesis. Neuron. 2000;25:307–316. [PubMed]
  • Legue E, Joyner AL. Genetic fate mapping using site-specific recombinases. Methods Enzymol. 2010;477:153–181. [PubMed]
  • Liu C, Sage JC, Miller MR, Verhaak RG, Hippenmeyer S, Vogel H, Foreman O, Bronson RT, Nishiyama A, Luo L, et al. Mosaic analysis with double markers reveals tumor cell of origin in glioma. Cell. 2011;146:209–221. [PMC free article] [PubMed]
  • Logie C, Nichols M, Myles K, Funder JW, Stewart AF. Positive and negative discrimination of estrogen receptor agonists and antagonists using site-specific DNA recombinase fusion proteins. Mol Endocrinol. 1998;12:1120–1132. [PubMed]
  • Long F, Zhang XM, Karp S, Yang Y, McMahon AP. Genetic manipulation of hedgehog signaling in the endochondral skeleton reveals a direct role in the regulation of chondrocyte proliferation. Development. 2001;128:5099–5108. [PubMed]
  • Matise MP, Auerbach AB, Joyner AL. Production of targeted embryonic stem cell clones. 2. Oxford: Oxford Press; 2005.
  • Mignone JL, Kukekov V, Chiang AS, Steindler D, Enikolopov G. Neural stem and progenitor cells in nestin-GFP transgenic mice. J Comp Neurol. 2004;469:311–324. [PubMed]
  • Muzumdar MD, Luo L, Zong H. Modeling sporadic loss of heterozygosity in mice by using mosaic analysis with double markers (MADM) Proceedings of the National Academy of Sciences of the United States of America. 2007;104:4495–4500. [PMC free article] [PubMed]
  • Papaioannou V, Johnson R. Production of chimera by blastocyst and morula injection of targeted ES cells. 2. Oxford: Oxford Press; 2005.
  • Raymond CS, Soriano P. High-efficiency FLP and PhiC31 site-specific recombination in mammalian cells. PLoS One. 2007;2:e162. [PMC free article] [PubMed]
  • Raymond CS, Soriano P. ROSA26Flpo deleter mice promote efficient inversion of conditional gene traps in vivo. Genesis. 2010;48:603–606. [PMC free article] [PubMed]
  • Ringwald M, Iyer V, Mason JC, Stone KR, Tadepally HD, Kadin JA, Bult CJ, Eppig JT, Oakley DJ, Briois S, et al. The IKMC web portal: a central point of entry to data and resources from the International Knockout Mouse Consortium. Nucleic Acids Res. 2011;39:D849–855. [PMC free article] [PubMed]
  • Saarimaki-Vire J, Peltopuro P, Lahti L, Naserke T, Blak AA, Vogt Weisenhorn DM, Yu K, Ornitz DM, Wurst W, Partanen J. Fibroblast growth factor receptors cooperate to regulate neural progenitor properties in the developing midbrain and hindbrain. J Neurosci. 2007;27:8581–8592. [PubMed]
  • Sakai K, Miyazaki J. A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochem Biophys Res Commun. 1997;237:318–324. [PubMed]
  • Sato T, Joyner AL. The duration of Fgf8 isthmic organizer expression is key to patterning different tectal-isthmo-cerebellum structures. Development. 2009;136:3617–3626. [PMC free article] [PubMed]
  • Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, Iyer V, Mujica AO, Thomas M, Harrow J, Cox T, et al. A conditional knockout resource for the genome-wide study of mouse gene function. Nature. 2011;474:337–342. [PMC free article] [PubMed]
  • Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–71. [PubMed]
  • Trichas G, Begbie J, Srinivas S. Use of the viral 2A peptide for bicistronic expression in transgenic mice. BMC Biol. 2008;6:40. [PMC free article] [PubMed]
  • Trokovic R, Trokovic N, Hernesniemi S, Pirvola U, Vogt Weisenhorn DM, Rossant J, McMahon AP, Wurst W, Partanen J. FGFR1 is independently required in both developing mid- and hindbrain for sustained response to isthmic signals. EMBO J. 2003;22:1811–1823. [PMC free article] [PubMed]
  • Zambrowicz BP, Imamoto A, Fiering S, Herzenberg LA, Kerr WG, Soriano P. Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:3789–3794. [PMC free article] [PubMed]
  • Zong H, Espinosa JS, Su HH, Muzumdar MD, Luo L. Mosaic analysis with double markers in mice. Cell. 2005;121:479–492. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...