• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of eidLink to Publisher's site
Emerg Infect Dis. Nov 2005; 11(11): 1758–1760.
PMCID: PMC3367346

Vibrio cholerae Pathogenic Clones

Abstract

We resolved the relationships between 2 pandemic clones of Vibrio cholerae. Using 26 housekeeping genes, we showed that the US Gulf clone, the Australian clone, and 3 El Tor strains isolated before the seventh pandemic were related to the seventh pandemic clone. The sixth pandemic clone was well separated from them.

Keywords: Vibrio cholerae, US Gulf Coast strains, pandemic clones, evolution, classical, El Tor, toxigenic, Australian strains, prepandemic strains, dispatch

Cholera caused by Vibrio cholerae is a major disease that has caused great fear since the first recorded pandemic in 1817 because of the frequency of death and the rapidity with which it occurs (1,2). Approximately 200 O antigens have been distinguished serologically (3,4), but only O1 and O139 have been found in epidemic and pandemic cholera isolates (5,6).

The seventh pandemic (1961–present) is still widespread and has a severe impact on 3 continents. The sixth pandemic ended in 1923, but the clone persisted at least until the 1990s (7). Furthermore, several cholera outbreaks were reported after the sixth pandemic retreated but before the start of the seventh pandemic. Isolates from these outbreaks were recognized as different from those of the sixth pandemic and were allocated to the El Tor biotype, while the sixth and fifth pandemics, both of which had been studied microbiologically, were referred to as the classical biotype. These El Tor outbreaks occurred in Indonesia and the Middle East (1926–1960) (5) and are often referred to as prepandemic isolates because they were later seen as forerunners of the seventh pandemic, which was also of the El Tor biotype. However, now that environmental V. cholerae has been studied in some detail, major components of the El Tor phenotype are known to be present in most environmental isolates, and the classical biotype is believed to have arisen by loss of characters otherwise widely present in the species (8). Also, cases of sporadic indigenous cholera have been detected in Australia (9) and the United States (10), both of the O1 El Tor biotype. These are generally referred to as the US Gulf and Australian clones. All of the pathogenic forms discussed above had the O1 serotype, but in 1992 a variant of the seventh pandemic appeared with a new O antigen, O139; this variant is known as V. cholerae O139 Bengal (11).

The relationships of V. cholerae have been studied in several ways, but the most useful insights have come from multilocus enzyme electrophoresis (12) and more recently by multilocus sequence analyses (4,13,14). In this study, we sequenced 26 housekeeping genes from V. cholerae isolates representative of the sixth and seventh pandemic clones and other closely related toxigenic strains to determine relationships to better understand the origins of pandemic clones.

The Study

Twenty-six housekeeping genes distributed evenly on both chromosomes (Table A1) were studied by using 5 nontoxigenic environmental isolates and 12 toxigenic V. cholerae isolates, which comprise 5 sixth and seventh pandemic isolates and 7 pathogenic isolates related to them (Table). One of the 3 seventh pandemic isolates is N16961; the sequence of its genome (15) was used in this study. All 26 housekeeping genes were successfully sequenced from the remaining 11 toxigenic isolates. However, 4 genes could not be amplified by polymerase chain reaction from 1 of the environmental isolates (sdaA for 370-94, hmpA for 905-93, glgX for 928-93, and pepN for 370-94) and were not sequenced. The GenBank accession numbers for the nucleotide sequences determined in this study are DQ020969-DQ021380.

The 5 nontoxigenic environmental isolates had different sequences for each gene. These sequences were not found in any of the 12 toxigenic isolates. The average pairwise difference among the 5 environmental isolates in the 22 genes sequenced ranged from 0.67% to 5.29%, an indication that V. cholerae as a species has a high level of sequence variation. However 11 of the 26 housekeeping genes (glyA, gppA, pntA, icd, purM, plsX, ndh, glgX, adk, carA, and speA) were identical in all toxigenic V. cholerae isolates, confirming that they are closely related.

There were 18 mutation/recombination events among the 15 genes with sequence variation in the 12 toxigenic isolates. Three (malP, pyrC, and gyrB) of these genes had undergone 2 changes. Seven cases of single base differences, which are attributed to mutation, were clearly distinct from 11 cases of multiple base differences, which are attributed to recombination. Ten of the events attributed to recombination involve changes in 10 to 51 bases (Figure 1). The metG gene, in which the 2 sequences differ by only 4 bases, might have undergone 4 mutational events rather than a single recombination event, but we considered this to be most unlikely.

Figure 1
Distribution of base differences in strains of Vibrio cholerae. The base positions relative to the start of the ATG codon are shown. Isolates 395 and E9120 were compared for the fruK, lytB, metE, pepN, pyrG, fumC, malP, metG, pyrC, and sdaA genes, and ...

Some of the 11 genes believed to have undergone recombination may have undergone >1 recombination event. This possibility is likely because 11 of 26 genes have undergone recombination. For example, in metE the base changes are at the 2 ends and may represent 2 recombination events; the same applies, to a lesser extent, to malP.

With regard to the length of DNA involved in recombination events, segments longer than a gene are most common because only in the genes discussed above and in sdaA and gyrB are the bases that differed clustered within the gene. This is suggestive of recombination within that gene.

The sequences for the 26 genes were used to produce a tree with mutational and recombinational events and given equal weight, which is shown in Figure 2. By sequencing 26 genes, we have observed sufficient variation to determine the relationships of the isolates studied. The tree is unrooted because the environmental isolates share no alleles with each other or toxigenic isolates. The relatively high rate of recombination in V. cholerae means that the level of sequence similarity does not indicate relatedness of the isolates unless the sequences are very similar and differences can be attributed to mutation, as in the toxigenic strains. However, other reasons exist for believing that the root is on the long 10-event branch that includes 2 mutational changes. The 10 El Tor isolates on 1 end are, at most, 3 steps from it and the 2 classical sixth pandemic isolates are separated by 1 event. The isolates date from 1937 to 1992 for the former group and from 1921 to 1965 for the latter group. Since 1 group giving rise to the other while undergoing little divergence itself is highly improbable, we believe that the root lies somewhere on that branch. The properties that characterize the El Tor biotype are those of environmental strains, which makes it unlikely that they are derived from the sixth pandemic, and the reverse seems even less likely because the fifth pandemic was also the classical biotype. We therefore treat the tree as being rooted on the long branch, which enables us to follow the sequence of events.

Figure 2
Relationships of toxigenic Vibrio cholerae isolates. The mutational (m) and recombinational (r) changes are given equal weight. Shown is a unique (unrooted) tree, with the events indicated on the branches.

Among the El Tor isolates, the Australian clone is the most closely related of the current clones to the seventh pandemic clone, with 1 and 2 events along the 2 branches separating them. The Australian clone, although not discovered until 1977, must have arisen before the seventh pandemic and spread to Australia. The prepandemic outbreak isolates are located separately among the surviving El Tor pathogenic clones, with the 1937 Indonesian 66-2 (Makassar 759) isolate located closest to the seventh pandemic clone. The US Gulf clone diverged before the Australian clone and the seventh pandemic clones diverged, with a single recombination event on the branch to the common ancestor of the Australian and the seventh pandemic clones.

The 2 sixth pandemic isolates are well separated from the other strains, differing from them at 10 loci, an average of 5 events per branch. These include recombination events affecting 8 genes. If representative, ≈30% of the genes have undergone recombination during divergence of the sixth pandemic clone and the El Tor group of pathogenic clones that includes the seventh pandemic clone. The extensive divergence between the sixth pandemic and other toxigenic isolates studied indicates a long period since divergence from the common ancestor, which presumably occurred well before the sixth pandemic (1899–1923). In the absence of any intermediates, we cannot allocate individual events to either branch but presume that each is equally likely to have occurred on either branch.

Conclusions

This study using sequences of 26 genes has resolved the evolutionary relationship of the 2 major pandemic clones of V. cholerae and the relationships of the seventh pandemic clone to other pathogenic El Tor clones and isolates. With the relationships established it is clear that study of the prepandemic isolates and Australian clone in particular could illuminate the events involved in the emergence of the current seventh pandemic clone from this lineage.

Acknowledgments

We thank all donors of isolates and the anonymous referees for their helpful suggestions.

This research was supported by grants from the National Health and Medical Research Council of Australia and a University of New South Wales Goldstar award.

Biography

• 

Ms Salim is a PhD student in microbiology at the University of Sydney. Her research interests include population genetics and evolution of V. cholerae.

Table A1

Chromosomal location of 26 genes of Vibrio cholerae and primers used*
GeneChromosomal location† (kb)Forward primerSequence (5´→3´)Position‡Reverse primerSequence (5´→3´)Position§Amplicon size, bp
gyrB114876TGGTTTTTGAGGTGGTGGAT1164877CGCTTGATTCTTACGGTTAC13301,214
udhA1414968GAAAAAGAGAGCAGTGTAGG1064969CGTCCCACTTCATAAGGCAC11311,025
purH2804970TCAGCGTATCAGATAAAACC354971CTTGCCATTCACCACACTCC11181,083
gppA3144972GCCGTTTCTTCACCCTTGTA104973GGATTTTTTGCCAGCCATTC14161,406
lytB7324974ATGAGCAAACCAATGAAAAT14975TTAGGCACTTCAAAGAACAT936935
adk10504873CATCATTCTTCTCGGTGCTC64967CACTCACTTCGCTCACTTGC620614
metG11024878CTGAACCCCGAAAAAGATAG314879CTGTGGAAATAAACGATGTC10501,019
icd12094965TTCATTACTGCCGATTATTC664966TTTGGTGTCTTTCTGCTTAC11291,063
pepN16025054CACACCTCAAGCCAAATACC95055GTACAGCTTCATGCCACGTT12191,210
fumC16844874TTATCAAGCACAAACTCAAC664875TCACAGGCAGCATCACATTA10791,013
metE18354987TTGCTCTTGAAAAATACTGG594988GAGAAGACTTACGCGCAACA11691,110
ndh20384989TTGAGGATTGTTGTTGTGAC14990GTTTTAATCATGCCGTGCAG12421,241
plsX21775009ATTTAACCGTTGCACTTGAT85010GGCTGGGTACTTGTCGTTTC980972
purM23804991GTGAGCGGTAATAATCCATC14992GCTTCGTTGCTATTGGCGGC10231,022
carA25574993CAGATGGTATTTCCGTCGGT654994AAAGTGGTCAAACAGCGGTG11111,046
pyrG26274995GCGGGGTTGTATCCTCTCTA294996TATTTGGTGTTTTTATTGAA12301,201
malP125056GAAACCTACTCAACAGAAAC35057CAGAGTGTGGTTGGTGTAAG10901,087
pncB1054999GTTTTCTCCCCACATCATTC155000TTCACACATGGCTTTTTCCG11891,174
hmpA2025001TGCTCACCCAAGAACACATC25002CGGACCACACAAATAGAA AT10811,079
glyA2965003ACACCCGCCAAAATGAACAG1105004CATAGGCTTCTCTTCGTCAA11111,001
fruK4465005TAACGGGCAGTGTAAACCAG475006GCGGATACTTGAATTTGTTG930883
pntA5005049AGAACAACTCGCTGGTGAAA215050ATGCCCCTACTACAATGATG14091,388
sdaA6024976AAGGGGAAAGTTATGCTCTC494977CATTTGCTGGTGCGCTTGAG13081,259
speA7615058TAATCCTCTCTGTTTTTGTG475059TGTTTTTCAGTAGCATTGGC12141,167
pyrC8785013TGACAACACTGACGATTACA265014TTGCGAGGTAGGCCGTAGAA936910
glgX9775060GTCAACGCCTTTCCCATTAG155061TTCGGCAATCAGCTTTACTT10511,036

*The annealing temperatures were 55–62°C for primers for gyrB and pepN and 55°C for the remaining primers.
†Location of each gene on the 2 chromosomes (large and small chromosomes) of V. cholerae isolate N16961.
‡Position of the first base of the forward primer relative to the first base of the start codon.
§Position of the first base of the reverse primer relative to the first base of the start codon.
¶Genes on the small chromosome of V. cholerae isolate N16961.

Table

Isolates of Vibrio cholerae tested
Original nameLaboratory nameClone/isolateYear isolatedLocationSource*SerogroupBiotype
#75M9676th pandemic1921JapanCDCO1Classical
395M16166th pandemic1965IndiaCVDO1Classical
E506M794US Gulf Coast1974Texas, USACVDO1El Tor
4808M796US Gulf Coast1978Louisiana, USACVDO1El Tor
NCTC 9420M640Pre-7th pandemic1954Cairo, EgyptNCTCO1El Tor
NCTC 5395M543Pre-7th pandemic1938Baghdad, IraqNICEDO1El Tor
66-2 (Makassar 759)M802Pre-7th pandemic1937Sulawesi, IndonesiaIPO1El Tor
SIMP/77M2140Australian1977AustraliaQHO1El Tor
M4287/77M2141Australian1977AustraliaQHO1El Tor
2100M6637th pandemic1992Bali, IndonesiaIMVSO1El Tor
E9120M7937th pandemic1961IndonesiaCVDO1El Tor
N16961†7th pandemic1971BangladeshGenBankO1El Tor
1085-93M549Environmental1993GermanyNIHJO37
141-94M553Environmental1994GermanyNIHJO70
905-93M555Environmental1993ArgentinaNIHJO97
928-93M557Environmental1993ArgentinaNIHJO6
370-94M563Environmental1994South KoreaNIHJO81

*CDC, Centers for Disease Control and Prevention; CVD, Centre for Vaccine Development (Dr James Kaper); NCTC, National Collection of Type Cultures; NICED, National Institute for Cholera and Enteric Diseases; IP, Institute Pasteur (Dr A. Dodin); QH, Queensland Health (Dr Denise Murphy); IMVS, Institute of Medical and Veterinary Science; NIHJ, National Institute of Health, Japan (Dr Tohio Shimada).
†Sequence of the genome of isolate N16961 was used. GenBank accession numbers for chromosomes 1 and 2 are AE003852 and AE003853, respectively.

Footnotes

Suggested citation for this article: Salim A, Lan R, Reeves PR. Vibrio cholerae pathogenic clones. Emerg Infect Dis [serial on the Internet]. 2005 Nov [date cited]. http://dx.doi.org/10.3201/eid1111.041170

References

1. Pollitzer R Cholera. Geneva: World Health Organization; 1959. p. 147–58.
2. Lacey SW Cholera: calamitous past, ominous future. Clin Infect Dis. 1995;20:1409–19.10.1093/clinids/20.5.1409 [PubMed] [Cross Ref]
3. Shimada T, Arakawa E, Itoh K, Okitsu T, Matsushima A, Asai Y, et al. Extended serotyping scheme for Vibrio cholerae. Curr Microbiol. 1994;28:175–8.10.1007/BF01571061 [Cross Ref]
4. Kotetishvili M, Stine OC, Chen Y, Kreger A, Sulakvelidze A, Sozhamannan S, et al. Multilocus sequence typing has better discriminatory ability for typing Vibrio cholerae than does pulsed-field gel electrophoresis and provides a measure of phylogenetic relatedness. J Clin Microbiol. 2003;41:2191–6.10.1128/JCM.41.5.2191-2196.2003 [PMC free article] [PubMed] [Cross Ref]
5. Barua D History of cholera. In: Barua D, Greenough III WB, editors. Cholera. New York: Plenum; 1992. p. 1–36.
6. Albert MJ Vibrio cholerae O139 Bengal. J Clin Microbiol. 1994;32:2345–9. [PMC free article] [PubMed]
7. Safa A, Bhuiyan NA, Alam M, Sack DA, Nair GB Genomic relatedness of the new Matlab variants of Vibrio cholerae O1 to the classical and El Tor biotypes as determined by pulsed-field gel electrophoresis. J Clin Microbiol. 2005;43:1401–4.10.1128/JCM.43.3.1401-1404.2005 [PMC free article] [PubMed] [Cross Ref]
8. Reeves PR, Lan R Cholera in the 1990s. Br Med Bull. 1998;54:611–23. [PubMed]
9. Desmarchelier PM, Wong FY, Mallard K An epidemiological study of Vibrio cholerae O1 in the Australian environment based on rRNA gene polymorphisms. Epidemiol Infect. 1995;115:435–46.10.1017/S0950268800058593 [PMC free article] [PubMed] [Cross Ref]
10. Johnston JM, Martin DL, Perdue J, McFarland LM, Caraway CT, Lippy EC, et al. Cholera on a Gulf Coast oil rig. N Engl J Med. 1983;309:523–6.10.1056/NEJM198309013090903 [PubMed] [Cross Ref]
11. Bhattacharya MK, Bhattacharya SK, Garg S, Saha PK, Dutta D, Nair GB, et al. Outbreak of Vibrio cholerae non-O1 in India and Bangladesh. Lancet. 1993;341:1346–7.10.1016/0140-6736(93)90855-B [PubMed] [Cross Ref]
12. Wachsmuth IK, Olsvik Ø, Evins GM, Popovic T Molecular epidemiology of cholera. In: Wachsmuth IK, Blake PA, Olsvik Ø, editors. Vibrio cholerae and cholera, molecular to global perspectives. Washington: ASM Press; 1994. p. 357–70.
13. Byun R, Elbourne LDH, Lan R, Reeves PR Evolutionary relationships of the pathogenic clones of Vibrio cholerae by sequence analysis of four housekeeping genes. Infect Immun. 1999;67:1116–24. [PMC free article] [PubMed]
14. Farfan M, Minana-Galbis D, Fuste MC, Loren JG Allelic diversity and population structure in Vibrio cholerae O139 Bengal based on nucleotide sequence analysis. J Bacteriol. 2002;184:1304–13.10.1128/JB.184.5.1304-1313.2002 [PMC free article] [PubMed] [Cross Ref]
15. Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, et al. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature. 2000;406:477–83.10.1038/35020000 [PubMed] [Cross Ref]

Articles from Emerging Infectious Diseases are provided here courtesy of Centers for Disease Control and Prevention

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • PopSet
    PopSet
    Published population set
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...