• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of jcmPermissionsJournals.ASM.orgJournalJCM ArticleJournal InfoAuthorsReviewers
J Clin Microbiol. May 2012; 50(5): 1815–1817.
PMCID: PMC3347137

First Report of Infectious Pericarditis Due to Bordetella holmesii in an Adult Patient with Malignant Lymphoma

Abstract

Bordetella holmesii is a fastidious Gram-negative rod first identified in 1995. Though rare, it is isolated mainly in immunocompromised and asplenic hosts and is associated with bacteremia, pertussis-like respiratory tract infection, and endocarditis. Herein, we describe a unique B. holmesii infectious pericarditis patient with malignant lymphoma.

CASE REPORT

A 71-year-old male was hospitalized because of fever and dyspnea on effort. He had received 8 cycles of chemotherapy for malignant lymphoma (diffuse large B cell lymphoma) over the prior year, but complete remission was not achieved. Because of a persistent lesion, we initiated maintenance therapy, including rituximab administration which was continued until the present hospitalization. Approximately 2 weeks prior to presentation, he complained of dyspnea on effort and a rising low-grade fever. Follow-up computed tomography (CT) suggested pericardial effusion (Fig. 1A), and pleural change was suspected (Fig. 1B). He was thus admitted under a diagnosis of possible pericarditis. Clinical examination findings on presentation were unremarkable other than a temperature of 37.5°C. Initial laboratory investigations revealed elevations of aspartate aminotransferase (AST) and alanine aminotransaminase (ALT) to 30 and 59 IU/liter, respectively (normal ranges, 10 to 28 and 5 to 33 IU/liter, respectively), an alkaline phosphatase level of 392 IU/liter (normal range, 104 to 338 IU/liter), a hemoglobin level of 11.1 g/dl (normal range, 12 to 18 g/dl), and a C-reactive protein (CRP) level of 22.99 mg/dl (normal value, less than 0.3 mg/dl). The white blood cell count was 6,200/μl, i.e., within normal limits. However, the percentage of segmented neutrophils was 86.5% (normal range, 38 to 58%). Serum electrolytes and creatinine were within normal limits. Chest radiographs showed slight cardiomegaly, whereas abdominal radiographs revealed no abnormalities. HBs antigen and anti-hepatitis C antibody were negative.

Fig 1
CT of the chest on admission shows massive pericardial effusion (A) (white solid line) and slight pleural and lung changes adjacent to the pericardium (B) (black dashed line). High-density lesions are seen in the pleura and lung parenchyma adjacent to ...

In view of the possibility of pericarditis, he received pericardial drainage therapy and empirical antimicrobial administration (ceftriaxone 2,000 mg/day) upon admission. The pericardial effusion was bloody and contained neutrophil-rich inflammatory cells but no malignant cells. Gram staining was negative. With empirical antimicrobial therapy, his clinical symptoms disappeared and pericardial effusion did not reaccumulate after drain removal. We ultimately removed more than 1,000 ml of pericardial effusion, and culture of approximately 20 ml of this effusion was started. Forty-eight hours after starting the culture, gray, smooth, round colonies less than 1 mm in diameter were isolated from blood agar (Eiken Chemical Co., Tokyo, Japan) (Fig. 2). There was no colony growth at 24 h when bacteria were inoculated onto 5% sheep blood agar plates and incubated in 5% CO2 under aerobic conditions, whereas they grew after 5 days on MacConkey agar (Oriental Yeast Co., Tokyo, Japan). Isolates were small Gram-negative coccobacilli on microscopic observation, and no motility was seen in sulfide-indole-motility medium. Furthermore, isolates were oxidase test negative and showed neither nitrate reduction nor urease production. We finally identified the strain with 16S rRNA genotyping, as previously described (7), as being Bordetella holmesii, and a similarity search was conducted using the BLAST program (DDBJ, Shizuoka, Japan). The results (1,456 bp) showed 100% similarity to the reference strain (GenBank accession no. DQ409136) (similarity to Bordetella pertussis [GenBank accession no. BX640420], 99.73%; similarity to Bordetella parapertussis [GenBank accession no. BX640434], 99.52; similarity to Bordetella bronchiseptica [GenBank accession no. BX640449], 99.52%). Furthermore, the isolates were confirmed by PCR detection of bhoE (2), a gene not found in B. pertussis but present in B. holmesii, using primers Bh-bhoE-F (TGGGGAGCAAACAGGATTAG) and Bh-bhoE-R (AGAGTGCCCTTTCGTAGCAA). Agglutination testing (Denka Seiken, Co., Ltd., Tokyo, Japan) for identification of B. pertussis was negative. Susceptibility to representative antimicrobial agents was determined by Etest on Mueller-Hinton agar. The present isolate was sensitive to ampicillin (MIC, 1 μg/ml), ceftriaxone (MIC, 1 μg/ml), clarithromycin (MIC, less than 2 μg/ml), and ciprofloxacin (MIC, less than 0.12 μg/ml). The patient's fever resolved within 2 days of commencing intravenous ceftriaxone, and the pericardial fluid did not reaccumulate after beginning antimicrobial therapy. He felt better, and CRP normalized. Administration of ceftriaxone was continued for 4 weeks, but myelosuppression associated with ceftriaxone administration developed. Ceftriaxone was thus switched to levofloxacin, in response to the ongoing neutropenia. He was given granulocyte-colony stimulating factor, and his neutrophil count normalized. On the 63rd hospital day, he was discharged in good condition.

Fig 2
Isolation of colonies from pericardial effusion, and microscopic view of isolates (the upper right panel, original magnification of ×1,000). Colonies grew slowly, and at least 48 h were required before they became observable. All colonies are ...

The genus Bordetella belongs to the Alcaligenaceae family, which is currently comprised of eight known species. Among representative species, B. pertussis is the causative agent of whooping cough (pertussis), and B. parapertussis and B. bronchiseptica have also been implicated in respiratory tract infections in humans. The present species, B. holmesii, was also recently reported to have been detected in patients with pertussis-like respiratory syndrome (6, 15). The other species, Bordetella avium, Bordetella hinzii, and Bordetella petrii, are rarely detected in respiratory samples from patients with chronic respiratory infectious diseases, including cystic fibrosis (4, 15, 18). Moreover, Bordetella trematum has also reportedly been detected in ear and wound infections (1, 19). Immunocompromised status is considered to be strongly associated with the establishment of infection due to these rare Bordetella species.

B. holmesii was first described in 1995 as a cause of sepsis in 15 patients (20), including at least three asplenic children, but no specific clinical findings were described. The first detailed clinical case report was published later that year. A 12-year-old male with a history of splenectomy for idiopathic thrombocytopenic purpura was diagnosed with sepsis due to B. holmesii. However, he complained only of low-grade fever, no other symptoms, and his physical state was essentially normal (8). Since then, B. holmesii has been reported as a causative microorganism of bacteremia, endocarditis, and community-acquired pneumonia. In these previous reports, it is noteworthy that most patients were in immunocompromised states, mainly the asplenic condition (2, 5, 10, 11, 12, 14, 16). Shepard and colleagues reported 26 patients with B. holmesii bacteremia, and 85% were in an anatomical or functional asplenic state (14). Moreover, the clinical courses were usually uneventful and relatively mild. Most patients recovered without complications.

The present case is the first description, to our knowledge, of infectious pericarditis due to B. holmesii. Bacterial pericarditis accounts for approximately 5% of all pericarditis cases (9, 13, 17) and occurs via direct infection during trauma, thoracic surgery, or catheter drainage by spread from an intrathoracic, myocardial, or subdiaphragmatic focus and by hematogenous dissemination. The frequent causative organisms are Staphylococcus spp. and Streptococcus spp., which often cause rheumatic pancarditis, Haemophilus spp., and Mycobacterium tuberculosis. M. tuberculosis is considered to be the most common microorganism causing bacterial pericarditis, because the pericardium can be reached via hematogenous spread or extension from adjacent organs, particularly the lungs or pleural space (13). In the present case, chest CT showed slight changes of the pleura and adjacent lung parenchyma (Fig. 1B and C). However, we were not able to obtain pleura or lung samples from the indicated regions and can only speculate that B. holmesii had migrated to the pericardium from the lung or pleural space.

We advocate that B. holmesii be considered among the possible causative microbes of infectious pericarditis. A recent report (15) showed B. holmesii to be strongly associated with pertussis-like respiratory syndrome caused by B. pertussis and B. parapertussis. Furthermore, B. holmesii was identified as a causative microbe of bacterial pneumonia (3). Hence, we consider B. holmesii to be not only a cause of sepsis or septicemia in immunocompromised or asplenic individuals but also a common cause of infectious respiratory system diseases associated with involvement of adjacent organs or tissues, including the pericardium. Future development of a rapid and specific technique to detect B. holmesii might have a major diagnostic impact.

In conclusion, B. holmesii is a rare but important cause of pericarditis. In view of the possibility of this microbe causing respiratory system disease, awareness of B. holmesii is warranted.

ACKNOWLEDGMENTS

We thank Bierta Barfod for editing the manuscript and Toshie Sekine for secretarial assistance.

We do not have financial relationships with any commercial entity with an interest in the subject of the manuscript.

Footnotes

Published ahead of print 29 February 2012

REFERENCES

1. Daxboeck F, Goerzer E, Apfalter P, Nehr M, Krause R. 2004. Isolation of Bordetella trematum from a diabetic leg ulcer. Diabet. Med. 21:1247–1248 [PubMed]
2. Diavatopoulos DA, et al. 2006. Characterization of a highly conserved island in the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J. Bacteriol. 188:8385–8394 [PMC free article] [PubMed]
3. Dörbecker C, et al. 2007. Community-acquired pneumonia due to Bordetella holmesii in a patient with frequently relapsing nephrotic syndrome. J. Infect. 54:e203–e205 [PubMed]
4. Fry NK, et al. 2007. A UK clinical isolate of Bordetella hinzii from a patient with myelodysplastic syndrome. J. Med. Microbiol. 56:1700–1703 [PubMed]
5. Greig JR, Gunda SS, Kwan JTC. 2001. Bordetella holmesii bacteraemia in an individual on haemodialysis. Scand. J. Infect. Dis. 33:716–717 [PubMed]
6. Harrington AT, Castellanos JA, Ziedalski TM, Clarridge JE, III, Cookson BT. 2009. Isolation of Bordetella avium and novel Bordetella strain from patients with respiratory disease. Emerg. Infect. Dis. 15:72–74 [PMC free article] [PubMed]
7. Kageyama A, et al. 2004. Nocardia arthritidis sp. nov., a new pathogen isolated from a patient with rheumatoid arthritis in Japan. J. Clin. Microbiol. 42:2366–2371 [PMC free article] [PubMed]
8. Lindquist SW, Weber DJ, Mangum ME, Hollis DG, Jordan J. 1995. Bordetella holmesii sepsis in an asplenic adolescent. Pediatr. Infect. Dis. J. 14:813–815 [PubMed]
9. Maisch B, Ristić AD. 2002. The classification of pericardial disease in the age of modern medicine. Curr. Cardiol. Rep. 4:13–21 [PubMed]
10. McCavit TL, Grube S, Revell P, Quinn CT. 2008. Bordetella holmesii bacteremia in sickle cell disease. Pediatr. Blood Cancer 51:814–816 [PubMed]
11. Morris JT, Myers M. 1998. Bacteremia due to Bordetella holmesii. Clin. Infect. Dis. 27:912–913 [PubMed]
12. Njamkepo E, Delisle F, Hagege I, Gerbaud G, Guiso N. 2000. Bordetella holmesii isolated from a patient with sickle cell anemia: analysis and comparison with other Bordetella holmesii isolates. Clin. Microbiol. Infect. 6:131–136 [PubMed]
13. Sagristà-Sauleda J, Barrabés JA, Permanyer-Miralda G, Soler-Soler J. 1993. Purulent pericarditis: review of a 20-year experience in a general hospital. J. Am. Coll. Cardiol. 22:1661–1665 [PubMed]
14. Shepard CW, et al. 2004. Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin. Infect. Dis. 38:799–804 [PubMed]
15. Spilker T, Liwienski AA, LiPuma JJ. 2008. Identification of Bordetella spp. in respiratory specimens from individuals with cystic fibrosis. Clin. Microbiol. Infect. 14:504–506 [PubMed]
16. Tang YW, et al. 1998. Bordetella holmesii-like organisms associated with septicemia, endocarditis, and respiratory failure. Clin. Infect. Dis. 26:389–392 [PubMed]
17. Troughton RW, Asher CR, Klein AL. 2004. Pericarditis. Lancet 363:717–727 [PubMed]
18. Vandamme P, et al. 1995. Bordetella hinzii sp. nov., isolated from poultry and humans. Int. J. Syst. Bacteriol. 45:37–45 [PubMed]
19. Vandamme P, et al. 1996. Bordetella trematum sp. nov., isolated from wounds and ear infections in humans, and reassessment of Alcaligenes denitrificans Ruger and Tan 1983. Int. J. Syst. Bacteriol. 46:849–858 [PubMed]
20. Weyant RS, et al. 1995. Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. J. Clin. Microbiol. 33:1–7 [PMC free article] [PubMed]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...