• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Autoimmun. Author manuscript; available in PMC May 1, 2013.
Published in final edited form as:
PMCID: PMC3312994
NIHMSID: NIHMS342970

Environmental Exposure, Estrogen and Two X Chromosomes are Required for Disease Development in an Epigenetic Model of Lupus

Abstract

Systemic lupus erythematosus (SLE) is an autoimmune disease primarily afflicting women. The reason for the gender bias is unclear, but genetic susceptibility, estrogen and environmental agents appear to play significant roles in SLE pathogenesis. Environmental agents can contribute to lupus susceptibility through epigenetic mechanisms. We used (C57BL/6 × SJL)F1 mice transgenic for a dominant-negative MEK (dnMEK) that was previously shown to be inducibly and selectively expressed in T cells. In this model, induction of the dnMEK by doxycycline treatment suppresses T cell ERK signaling, decreasing DNA methyltransferase expression and resulting in DNA demethylation, overexpression of immune genes Itgal (CD11a) and Tnfsf7 (CD70), and anti-dsDNA antibody. To examine the role of gender and estrogen in this model, male and female transgenic mice were neutered and implanted with time-release pellets delivering placebo or estrogen. Doxycycline induced IgG anti-dsDNA antibodies in intact and neutered, placebo-treated control female but not male transgenic mice. Glomerular IgG deposits were also found in the kidneys of female but not male transgenic mice, and not in the absence of doxycycline. Estrogen enhanced anti-dsDNA IgG antibodies only in transgenic, ERK-impaired female mice. Decreased ERK activation also resulted in overexpression and demethylation of the X-linked methylation-sensitive gene CD40lg in female but not male mice, consistent with demethylation of the second X chromosome in the females. The results show that both estrogen and female gender contribute to the female predisposition in lupus susceptibility through hormonal and epigenetic X chromosome effects and through suppression of ERK signaling by environmental agents.

Keywords: Extracellular Receptor Kinase (ERK), Systemic Lupus erythematosus (SLE), Mouse

1. Introduction

Systemic lupus erythematosus (SLE) is a chronic, relapsing autoimmune disease afflicting 1.5 million Americans, 90% of whom are women [1]. SLE affects many organs among which are joints, skin, kidneys, heart, lungs, blood vessels and the brain. Disease ensues when abnormally functioning B and T lymphocytes form autoantibodies to DNA and nuclear proteins, resulting in immune complexes that cause inflammation and tissue damage. While the cause(s) of SLE are unknown, its etiology involves genes that confer susceptibility, as well as hormones and environmental factors [2, 3]. Evidence for a genetic contribution comes from familial aggregation in 20% of lupus cases, a higher concordance rate in monozygotic twins (~25%) compared to dizygotic twins (2%), and known lupus-associated polymorphisms in genes encoding HLA molecules, complement components, cytokines and programmed cell death proteins as well as others [4, 5]. Of the genetic factors predisposing to SLE, female gender is the strongest. The reason this autoimmune disease primarily affects women is poorly understood. Estrogen is thought to be one explanation for the gender dimorphism in lupus and is supported by data from animal models showing that disease is ameliorated by oophorectomy and exacerbated by estrogen administration [6]. However, estrogen is probably more important in disease severity [7] since the incidence of SLE still shows female gender preference in children (6:1 female: male ratio) and postmenopausal women (4:1) compared with men of the same age [8].

Another explanation for the female predominance in SLE may be the aberrant activation of immune response genes on the inactive X chromosome [9, 10]. Men with Kleinfelter's Syndrome (47, XXY) have a higher incidence of lupus than men in the general population [11] while there is a striking absence of SLE in women with Turner's Syndrome (45, XO) suggesting that two X chromosomes may predispose to SLE [12]. Because males have one X chromosome while females have two, most of the genes on the second X chromosome in females are silenced by epigenetic mechanisms that include DNA methylation as well as histone deacetylation, trimethylation and ubiquination [13, 14]. Inappropriate activation of immune genes on the normally silenced X chromosome, caused by DNA demethylation, may thus contribute to increased prevalence of SLE in women [10, 15]. One such X chromosome gene, CD40LG, encodes a B cell costimulatory molecule transiently expressed on the surface of activated T cells and is demethylated and overexpressed on T cells from women but not men with SLE [9, 10, 16]. In mice, CD40L plays an important role in promoting lupus-like pathogenic IgG auto-antibodies and kidney disease [17, 18].

Environmental agents can alter T cell gene expression through effects on DNA methylation, resulting in autoreactive T cells that promote autoimmunity. Evidence for an environmental component in SLE arises from observations that the majority of lupus cases are idiopathic, drugs such as procainamide, hydralazine and others as well as UV light trigger lupus-like autoimmunity [19], and the incomplete concordance between genetically identical twins [20]. The way environmental agents interact with the various genetic loci to induce lupus is unclear. However, work for our group showed that 5-azacytidine, an inhibitor of DNA-methyltransferase (DNMT1) activity, causes hypomethylation and over-expression of immune genes ITGAL (CD11a), TNFSF7 (CD70), KIR genes and CD40LG in T lymphocytes ([9, 2125]. In mice, adoptive transfer of experimentally demethylated murine T cells caused anti-dsDNA antibodies and lupus-like disease in the recipients [26, 27]. Furthermore, ERK pathway signaling is an important regulator of DNMT1 and is decreased in hydralazine-treated T cells and in T cells from patients with idiopathic lupus [19]. Therefore, environmental agents that inhibit ERK signaling, its upstream regulator PKC-δ, or other conditions such as diet and aging, that impact DNMT1 activity may increase methylation-sensitive gene expression through epigenetic mechanisms to cause a lupus-like disease in genetically predisposed individuals [3, 28, 29].

The mechanism by which genes, hormones and environmental factors interact to cause lupus is unknown. Animal models of SLE have revealed a wealth of information about specific genes that can contribute to development of a spontaneous, lupus-like disease and the influence hormones have on disease development [30]. However, they cannot be used to address gene-environment interactions in SLE because in the existing animal models, the disease develops spontaneously and once begun, continues to progress without environmental input. We previously developed a transgenic mouse model with an inducible ERK pathway signaling defect that is sufficient to decrease DNMT1 expression, cause over-expression of methylation-sensitive genes in mature T cells and induce anti-dsDNA IgG antibody in C57BL/6J mice, a non-autoimmune prone mouse strain [31]. In the present study, we used a transgenic hybrid (C57BL/6J × SJL)F1 mouse strain, with the same inducible T cell DNA methylation defect but which also has lupus-susceptibility genes and develops a more severe lupus-like disease only with exogenously-induced transgene activation. We used this model to clarify the interaction of genes, gender, hormones, and environmental influences on SLE induction and female prevalence.

2 Materials and Methods

2.1. Animals

SJL/J mice were purchased from Jackson Laboratories (Bar Harbor, ME). C57BL/6 mice bearing the TRE2-dnMEK and CD2-rtTA transgenes [31] were bred and maintained in a specific pathogen-free facility by the Unit for Laboratory Animal Medicine at the University of Michigan in accordance with National Institutes of Health and American Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International Guidelines. The animals were housed in filter-protected cages and provided with standard irradiated PicoLab Rodent Diet 20 (LabDiet, Brentwood, MO) and water ad libitum. All procedures were approved by the University of Michigan Institutional Animal Care and Use Committee.

C57BL/6.dnMEK+.CD2rtTA+ mice were bred with SJL animals and the F1 progeny screened by PCR for the presence of both transgenes. Protein and hemoglobin in mouse urine was measured by Chemstrip 6 dipstick (Roche, Madison, WI). Four mg/ml doxycycline (DOX) (Sigma, St. Louis, MO)/5% glucose was administered in the drinking water of selected groups of mice. Where indicated, 6–8 week old female mice were oophroctemized and males were orchiectomized. The animals were allowed to recover from the surgery (approximately 4 weeks), before being used in an experiment.

2.2. Antibodies and Flow Cytometry

The following antibodies were used in this study: PE-Hamster anti-mouse CD154 (CD40L), PECy5-rat anti-mouse CD4, anti-CD11a (BD Pharmingen, Fullerton, CA), HRP-Goat anti-mouse IgG-Fc-specific (Bethyl Labs, Montgomery, TX), HRP-goat anti-mouse Ig (H+L) (Southern Biotech, Birmingham, AL) and mouse monoclonal anti-dsDNA (Chemicon Intl, Temecula, CA). The cells were stained, fixed in 2% paraformaldehyde, and analyzed using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ) as previously described [22].

2.3. ELISA

Mouse anti-dsDNA IgG antibodies were measured by ELISA as follows. Costar (Corning, NY) 96 well microtiter plates were coated overnight at 4° C with 10 μg plasmid dsDNA per ml PBS, pH 7.2. Two to five microliters of mouse sera or murine monoclonal anti-dsDNA antibody were added to each well and incubated overnight at 4° C. Bound anti-dsDNA antibody was detected using HRP-goat anti-mouse IgG and OneStep Ultra TMB substrate (Thermo, Rockford, IL) and measured at 450 nm in a SpectraMax Pro spectrophotometer equipped with Softmax Pro software (Molecular Devices, Sunnyvale, CA). Mouse anti-dsDNA IgG antibody levels were confirmed using Alpha Diagnostic ELISA kits (San Antonio, TX).

2.4. Estrogen

One mm pellets containing β-Estradiol (90 day release, 0.72mg/pellet) or placebo (Innovative Research of America, Sarasota, FL) were implanted using a trocar, under the skin on the left side of the necks of anesthetized, double transgenic male and female mice that had been surgically neutered. Ninety days later a second identical β-estradiol or placebo-containing pellet was implanted on the right side of the neck. At the end of the experiment, estrogen levels were measured in murine plasma using an Estradiol EIA Kit (Caymen Chemical Co, Ann Arbor, MI) according to the manufacturer's instructions.

2.5. RNA and DNA Isolation and Real-Time Quantitative RT-PCR

Total RNA and DNA were simultaneously isolated from bead-purified (Miltenyi, Auburn, CA) CD4+ T cells using a Qiagen All-Prep RNA/DNA/Protein Mini Kit (Qiagen, Valencia, CA). The RNA and DNA were quantified using a NanoDrop 1000 spectrophotometer (NanoDrop Products, Wilmington, DE). One microgram of total RNA per sample was used to synthesize cDNA using a Transcriptor First Strand cDNA Synthesis Kit and anchored oligo(dT)18 primers (Roche, Indianapolis, IN) according to the manufacturer's instructions. Primers for murine mRNA were as follows: CD11a, F 5'-CGGGACGATTTTGTAACATA GGTC-3', R 5'-GCCCTGCTAAAACATTGTATCCAG-3'; dnmt1: F. 5'-GGAAGGCTACCT GGCTAAAGTCAAG-3', R. 5' ACTGAAAGGGTGTCACTGTCCGAC; CD70: F. 5'-TGGCTGTGGGCATCTGCT-3', R. 5'-ACATCTCCGTGGACCAGGTATG-3'; CD40lg: F. 5'-ATACCCACAGTTCCTCCCAGCTTT-3', R. 5'-TAGGACAGCGCACTGTTCAGAGTT-3'; kirl1: F. 5' AGACTTTGTTCTGGCTCTGCTCCT-3, R. 5'TTCCCAAGTTGTCTGACATC CTCT-3'; β-actin: F. 5'-TTGCTGACAGGATGCAGAAGGAGA-3, R. 5'-ACTCCTGCTTGC TGATCCACATCT-3. The primers were obtained from Integrated DNA Technologies (Coralville, IA). RT-PCR reactions to quantitate gene expression were carried out using QuantiTect Fast Start SYBR Green PCR Master Mix (Qiagen, Valencia, CA) and Light-Cycler, 0.25U Uracil-DNA Glycolase (Roche) with 1μl template cDNA, 0.5μM forward and reverse primers in a total volume of 20 μl and amplified under the following conditions: 50° C 2 min., 95° C 10 min (94° C 15 s, 56° C 30 s, 72° C 30 s) 36 cycles, using a Rotor-Gene 3000 (Corbett Robotics, San Francisco, CA). Mice were genotyped for the presence of the dnMEK and CD2rtTA transgenes using genomic DNA isolated from tail snips (Qiagen Blood & Tissue Kit) using primers and PCR methods previously described [31]. Product formation was verified using melting curve analysis and by 2% agarose gel electrophoresis.

2.6. Bisulfite conversion and pyrosequencing CD40lg

Genomic DNA was isolated from CD4+ T cells using the DNeasy blood and tissue kit (QIAGEN), and then bisulfite treated using the EZ DNA Methylation-Gold kit (ZYMO Research, Irvine, CA). The pyrosequencing primers were designed using PSQ Assay Design software (Biotage, Uppsala, Sweden). PCR was performed using PyroMark PCR kit (QIAGEN) under the following conditions: initial incubation 95° C for 15 min, then 55 cycles of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 30 s for the CD40L promoter. Biotinylated PCR products were immobilized on streptavidin-coated sepharose beads (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). 40 μl of binding buffer including 2 μl streptavidin-coated sepharose beads was added to 40 μl of PCR product and mixed using a shaker, incubating at room temperature for 10 min while agitating constantly to keep the beads dispersed. The biotinylated amplicon was purified and denatured using a PyroMark Vacuum Prep Workstation (Biotage, Uppsala, Sweden). The DNA was resuspended in 14 μl annealing buffer containing 0.5 μm sequencing primer in a 96-well PSQ96 plate (Biotage). The sequencing primers were allowed to anneal on a heat plate set to 85 °C for 2 min then the samples were cooled to room temperature. After completion of primer annealing, sequencing was run on the Pyro Mark MD system (Biotage) with Pyro Gold Reagents (Biotage) according to the manufacturer's instructions. Data were analyzed using Pyro Q-CpG Software (Biotage). Statistical analysis was performed using Student's t-test.

CD40lg pyro-PCR primers: F: 5'-GGGAAAGTTTGGAAGTGAATGATA-3', R: Biotin-5'-CAACAAAAAACACAAATCCAATCA-3', sequencing primer 1: 5'-TTTGTTGGGAT AGAAGATTA-3', sequencing primer 2: 5'-AGTTTTTAGTTAGTATGATAGA-3'.

2.7. Cell Culture

Spleen cells were isolated and cultured for 24 hr with 5 μg/ml concanavalin A (Sigma Chem Co, St. Louis, MO) in RPMI 1640 medium containing 10% fetal bovine serum, 1% Pen strep (GIBCO, Grand Island, NY), 100 mM HEPES, 4 mM glutamine at 37° C in 5% CO2 balanced air. For CD40lg expression, the cells were washed and cultured for an additional 6 hr with fresh medium containing 5 ng/ml phorbol-13-myristate 12-acetate (PMA) and 500 ng/ml ionomycin. In some experiments, spleen cells were stimulated overnight with Con-A and treated with 5μM 5-azacytidine (5-azaC) for 4 days. CD4+ T cells were isolated using magnetic bead technology (Miltenyi Inc., Auburn, CA). Cell pellets were stored at −80° C for later RNA and DNA extraction.

2.8. Histopathology

Female and male (C57BL/6 × SJL)F1 mice with the dnMEK and CD2rtTA transgenes were treated for 16 wk with 4mg/ml DOX/5% sucrose in their drinking water. Control groups included double transgenic littermates treated with 5% sucrose alone and littermates lacking transgenes but treated with the DOX/sucrose or sucrose alone. At the end of an experiment, the animals were terminated and their kidneys bisected. Half of the tissue was embedded in O.C.T. (Thermo Fisher) and snap frozen in liquid nitrogen while the other half of the kidney was fixed in 10% formalin, paraffin embedded and stained with H&E. Five micron sections were cut from the frozen tissue and fixed for 10 minutes in ice cold acetone. Non-specific sites were blocked with 10% horse serum/PBS and the sections were stained for mouse IgG deposits using a 1:50 dilution of biotin-Goat anti-mouse IgG(Fc specific) antibody (US Biologicals)/FITC-Strepavidin (BD Pharmingen).

2.9. Statistical analysis

Student's t-test, linear regression or ANOVA as appropriate, were used to determine the significance of differences between groups using SYSTAT software on a Dell PC Optiplex 745 microcomputer.

3. Results

3.1. Influence of gender on serum anti-dsDNA antibody

The treatment protocols and results for our study are summarized in Table S1. Male and female dnMEK+CD2rtTA+(C57BL/6 × SJL)F1 mice were given water with DOX /5% glucose or 5% glucose for 4 – 24 weeks. Control groups included littermates lacking both transgenes but treated with the DOX/sucrose or sucrose alone. DOX treatment induced anti-dsDNA IgG antibody in double transgenic female animals compared to non-DOX treated controls (p=0.01, Fig. 1A). In contrast, DOX treatment failed to induce anti-dsDNA antibody in double transgenic male mice (p >0.05 male DOX+ vs. DOX, Fig 1B). In the absence of the transgenes, no anti-dsDNA antibody was induced by DOX treatment of male or female littermate controls (Fig 1B). The increase in anti-dsDNA IgG antibody in female versus male DOXtreated mice (p<0.005 by regression analysis) was not due to polyclonal Ig elevation since there was no difference found in the amount of total IgG in the sera of any of the groups (not shown).

Fig 1
Effects of decreased ERK signaling and gender on anti-dsDNA antibody. A. IgG anti-dsDNA antibody was measured in male (M) and female (F) (C57BL/6 × SJL)F1 mice bearing the dnMEK and CD2rtTA transgenes (+/+) and given 4 mg/ml DOX/5% glucose (DOX+) ...

3.2. Pathology

The effect of impaired ERK signaling on lupus-associated glomerulonephritis was investigated. Kidneys from dnMEK+CD2rtTA+(C57BL/6 × SJL)F1 mice from Fig. 1 were bisected, half snap frozen and stained for IgG and half paraffin embedded and stained with H & E. In the absence of DOX treatment no IgG was found in the glomeruli of female double transgenic mice (Fig 2A) and no glomerulonephritis was found by light microscopic examination (Fig 2B). No IgG was present in the kidneys of double transgenic male, DOX-treated mice or any non-transgenic littermate (not shown), consistent with the lack of anti-dsDNA antibodies in these animals. In contrast, IgG was found in the glomeruli of all 4 DOX-treated female double transgenic mice (Fig. 2C and D) (p=0.001 DOX+ female vs. male). The kidneys of these animals exhibited a glomerulonephritis with glomerular hypercellularity including leukocyte infiltration and evidence of nuclear karyorrhexis (Fig 2E, arrows). Hemoglobin (50–100 erythrocytes/μl) was present in the urine of 4 of 7 female but only 1 of 5 male double transgenic, DOX-treated mice, but the differences were not statistically significant (p>0.05, data not shown). In the absence of the transgenes or DOX treatment, no hematuria was observed. Taken together, the data indicate that impaired ERK signaling induced lupus-like disease in genetically susceptible female but not male animals. Furthermore, neither antibody nor disease developed in animals that possessed susceptibility genes in the absence of impaired ERK signaling.

Fig. 2
Glomerular IgG immune complex deposition in transgenic mice. Kidneys from female and male (C57BL/6 × SJL)F1 mice from Fig. 1 were bisected and half of the tissue snap frozen, the remaining half fixed in 10% formalin and paraffin embedded. Five ...

3.3. Gene Expression

We next tested whether impaired ERK signaling decreased DNMT1 gene expression with downstream effects on the expression of methylation-sensitive genes. Spleen cells from the mice shown in Figure 1 were stimulated with Con-A, cultured, then restimulated with PMA and ionomycin as described in materials and methods. CD4+ T cells were then isolated and gene expression measured by quantitative real-time PCR. CD4+ T cells from both male and female double transgenic mice made large amounts of dnMEK mRNA relative to actin (Fig 3A) in response to DOX treatment. Activation of dnMEK gene expression significantly (p=0.03) reduced DNMT1 mRNA (Fig 3B) compared to their untreated controls. Reduced DNMT1 levels resulted in overexpression of the methylation-sensitive autosomal genes encoding CD70 (Fig 3C) and CD11a (Fig 3D) in these same T cells from both female and male transgenic mice (Fig 3). Since male and female CD4+ T cells showed comparable patterns of gene expression in response to DOX treatment, we hypothesized that other, gender-related factors were responsible for the female restricted anti-dsDNA antibody and glomerular nephritis. Therefore, we further investigated the role of sex hormones and X chromosome genes in the female predominance of SLE.

Fig. 3
Effect of reduced ERK signaling on gene expression in male and female CD4+ T cells. Male and female transgenic mice were treated for 1 week with DOX or vehicle. Their spleen cells were isolated, treated for 24hr with Con-A, CD4+ T cells isolated then ...

3.4. Estrogen

To examine the role of estrogen in our model, male and female double transgenic mice were neutered, implanted with time-release pellets delivering placebo or 17β-estradiol and given DOX/5% sucrose or 5% sucrose alone in their drinking water. Blood and urine were collected at 4 week intervals for 20 wks. Anti-dsDNA IgG antibody results are shown in Fig. 4. Estrogen levels were measured in serum at final (20 wk) time point. Normal estradiol levels in mouse serum range from 14 – 104 pg/ml depending on the estrus cycle and age of the mouse [32]. Sham operated, control (hormonally intact) female mice had 15 pg estrogen/ml serum. No estrogen was detectable in the sera of male controls. Similarly no estrogen was detectable in the sera of neutered female or male mice implanted with placebo-containing pellets. Oophroctemized females implanted with estrogen pellets had 144 +/− 40.8 pg/ml (mean +/− S.D., n=5) serum estrogen. Orchiectomized males implanted 17β-estradiol pellets had comparable levels of estrogen (126.8 +/− 31.2 pg/ml, n=3) in their serum. DOX-treated female mice exhibited glomerular nephritis but the kidneys of both neutered female and male, estrogen-treated mice were badly damaged by severe hydronephosis (not shown). Both neutered female and male estrogen-treated mice developed bladder outlet obstruction and hydronephrosis when treated with high dose estrogen for prolonged periods of time [3335]. The pathologic effects of high dose estrogen is unique to mice as other species do not develop these conditions [36] and may be due to regulation of neuronal nitric oxide synthase [37].

Fig. 4
Estrogen and two X chromosomes are required to make anti-dsDNA antibody in response to impaired ERK pathway signaling. Neutered and estrogen or placebo supplemented dnMEK+CD2rtTA+ transgenic mice were given DOX/5% glucose (DOX+) or 5% glucose alone (DOX−) ...

DOX induced high levels of anti-dsDNA IgG antibodies in neutered, estrogen-supplemented female but not male mice (P<0.001, Fig. 4). No anti-dsDNA antibody was observed in DOX-treated intact or neutered, placebo-treated male transgenic mice. In the absence of DOX treatment, high levels of estrogen had a slight but significant effect on anti-ds-DNA antibody levels in female mice compared to either DOX-treated (p=0.003) or untreated (p=0.048) male mice. These results, taken together, demonstrate that estrogen and environmental factors that impair ERK signaling act synergistically to enhance anti-dsDNA antibody. However, female gender, independent of estrogen, is also required for SLE in this model.

3.5. X-chromosome gene expression and methylation

Since females have two X chromosomes and demethylation of genes on the second X may be responsible for the predominance of lupus in women, we examined the expression of the X-linked, methylation-sensitive CD40lg gene in our mouse model of SLE [9, 38]. DOX-treated female mice had twice the level of CD40L protein on their CD4+ T cells compared with male animals (MFI 30.85 ± 5.65 vs. 14.72 ± 0.94, p=0.02, n=4/group), consistent with demethylation of the second X chromosome in the females (Fig. 5A). We therefore examined the methylation status of the CD40lg gene in these T cells using pyrosequencing. Methylation patterns of the CD40lg promoter were compared in CD4+ T cells from male and female mice treated for 20 wk with DOX or vehicle. The genomic organization of the human and murine CD40L genes are identical [38] and the region of the CD40L gene from −250 to +405 bases relative to the transcription start site (TSS) was 87% homologous between mice and humans. We examined seven CG pairs in the murine CD40lg promoter within 150 bases of the transcription start site. Three of these CG pairs, −35, −43, and −46 5' of the TSS are homologous to CG pairs in the human CD40LG promoter and are demethylated in T cells from female lupus patients and 5-azaC treated cells from healthy women [9]. The first 4 CG pairs 5' to the CD40lg TSS, which included all three human homologs, were demethylated in the female double transgenic mice treated with DOX (74.2 ± 0.86% vs. 65.2±1.4% methylated, n=4/group, p=0.003 by regression), Fig 5B. In vitro treatment of CD4+ T cells with 5-azaC confirmed that the four CG pairs 5' to the TSS were methylation-sensitive in female (Fig. 5C) but not male (Fig 5D) T cells. CD40lg was constitutively less methylated in the males (38.2 ± 2.7%, n=3/group, p=1.3×10−6 vs. females) and did not demethylate further with 5-aza-C or DOX treatment (not shown). We previously reported that demethylation of the human CD40LG promoter in this region increases CD40LG gene expression and protein in CD4+ T cells from women [9]. Thus CD40lg in mice, like humans, appears to be methylation-sensitive and may increase gene expression exclusively in females through DNA hypomethylation.

Fig. 5
X chromosome gene CD40L expression and demethylation in CD4+ T cells. (A) CD4+ T cells from dnMEK+CD2rtTA+ male and female DOX-treated (DOX+) or control (DOX−) mice were stained with FITC-CD40L antibody then mean fluorescence intensity was analyzed ...

We further explored the activation of genes on the inactive X chromosome in the female lupus mice by examining the expression of a second gene, Kirl1, the mouse homolog to the human KIR2DL2 gene [39]. Human KIR genes are located on autosomes and are not expressed on normal CD4+ T cells, but their expression is upregulated in CD4+ T cells from healthy women by the irreversible DNA methyltransferase inhibitor 5-azaC, and in women with SLE [21, 40]. However, kirl1 is located on the X chromosome in mice [39]. We found that kirl1 mRNA was overexpressed in CD4+ T cells from ERK-impaired double transgenic female mice (DOX+ 1.96±0.4 vs DOX, 0.95± 0.18, mean ± SEM, n=4–8/group, p=0.02). However, kirl1 expression was not upregulated in male CD4+ T cells (DOX+ 0.5 ± 0.4 vs DOX 0.26 ± 0.17, p=0.16), but the difference in kirl1 expression between male and female mice receiving DOX was significant (p=0.02). The aberrant expression in mice of kirl1 mRNA in female but not male CD4+ T cells further supports our hypothesis that X chromosome genes play a role in determining female gender susceptibility to SLE.

4.Discussion

T cell DNA methylation is impaired in lupus, causing aberrant overexpression of genes that make the cells pathogenic, both in animal models and in human SLE [19]. DNA methylation patterns are maintained by DNMT1, which is regulated in part by ERK signal transduction [4143]. We therefore used a transgenic C57BL/6 mouse model in which ERK signaling was inducibly impaired. The dnMEK transgene contains three mutations - substitutions of serines 218, 222 and lysine 97 to alanine - and a tetracycline response element. A second transgene, CD2rt-TA, containing a reverse tetracycline transactivator under the control of a CD2 promoter restricts the dnMEK activity to T cells. In the presence of DOX, the dnMEK causes a ~60% reduction in phosphorylation of its substrate ERK, only in T cells [31]. Using this model we previously reported that reduced ERK signaling lowered DNMT1 mRNA levels, resulting in increased expression of the methylation-sensitive genes encoding CD11a and CD70 and the formation of anti-dsDNA IgG antibodies in female mice. However, no kidney disease was observed because the C57BL/6 mice carrying the transgenes appear to lack genes that contribute to organ-specific disease observed in human lupus. Clinical manifestations of lupus-like disease in mice are strain-dependent, requiring additional genes for full disease development [30]. This situation is similar to hydralazine-induced autoimmunity in humans [44]. SJL mice possess lupus-susceptibility genes making them susceptible to chemically induced lupus but they do not spontaneously develop the disease [45, 46]. Therefore, we made dnMEK+CD2rtTA +(C57BL/6 × SJL)F1 hybrid animals and used them in the present study to investigate the role of gender on lupus disease when ERK was similarly impaired. Our results confirm that impaired ERK signaling resulted in increased IgG anti-dsDNA antibody in female double transgenic mice. They further showed that male mice failed to make anti-dsDNA antibody even when both transgenes were present and activated by DOX treatment (Figs. 1, ,3).3). The presence of IgG anti-dsDNA antibody correlated with kidney disease, since no disease was observed in kidneys from the females in the absence of DOX, or in male mice either in the presence or absence of DOX. DOX activated dnMEK, decreased DNMT1 mRNA and enhanced CD70 and CD11a gene expression in males comparable to female mice. Therefore the failure in males to produce pathogenic antibody must result from sex hormones or other gender-specific differences.

Sex hormones are thought to be responsible for the female predominance observed in SLE. The role of estrogen, which influences both humoral and cellular immunity, has been widely studied and particularly in the NZB/W F1 mouse model of spontaneous SLE [47]. Female NZB/W F1 females die of SLE more rapidly than do males [6, 48]. Autoantibody formation is accelerated by estradiol treatment of the females [6, 49] while tamoxifen, an estrogen blocker, ameliorates disease progression [50]. However, estrogen may be more important in mediating disease severity than incidence. In people, lupus tends to flare during pregnancy [51] and estrogen supplementation is associated with mild lupus flares [52]. Our observation that estrogen greatly enhanced anti-dsDNA antibody only in female mice when ERK was impaired supports this hypothesis.

While estrogen may increase the frequency and severity of lupus flares, sex hormones do not completely explain female predisposition to SLE. Lupus primarily affects women of child-bearing age (15–44 years), at a female to male ratio of 9:1. However, female prevalence is still seen in pre-pubescent girls [53] and post-menopausal women [8] indicating that other factors besides estrogen contribute to SLE [54, 55]. DNA demethylation may affect women more than men because women have two X chromosomes, one of which is silenced by epigenetic mechanisms including DNA methylation [13, 14] . Inappropriate activation of immune genes on the X chromosome may thus contribute to increased prevalence of SLE in women [10, 15]. One such X chromosome gene, CD40LG, encodes a B cell co-stimulatory molecule transiently expressed on the surface of activated T cells and is overexpressed on T cells from women but not men with SLE [9, 10, 16]. In mice, CD40L was shown to play an important role in promoting pathogenic IgG auto-antibodies and kidney disease [17, 18]. We found that ERK impairment resulted in overexpression of CD40L protein on CD4+ T cells in female but not male mice and that the level of CD40L protein was twice the amount in females compared to males. This finding is consistent with re-expression of the CD40L gene on the inactive X chromosome and similar to what is observed in 5-azaC treated T human cells from healthy donors and in CD4+ T cells from lupus patients [9, 10]. Pyrosequencing of DNA from our ERK-impaired murine CD4+ T cells revealed that the promoter region of the mouse CD40lg, which is highly homologous with human CD40LG [9, 38, 56, 57], was largely demethylated in male mice while the gene was only partly demethylated in females. Suppression of ERK activity or inhibition of DNA-methyltransferases resulted in further demethylation of sequences on the inactive X chromosome only in females. Because one chromosome is inactivated by epigenetic processes including DNA methylation, the methylated gene is from the inactive X. Three of the seven CG pairs analyzed in the murine promoter were homologous with human sequences and in humans these CG pairs were among those that regulated human CD40LG function [9]. Thus, changes in methylation of these residues suggest that they are transcriptionally relevant in mice as well as humans. CD40LG regulatory sequences demethylated by 5-azaC treatment in mice at the same CG sites as those demethylated in women and in women with lupus. In human CD4+ T cells, CD40LG function is also affected by methylation of CG pairs in an enhancer located 5' (−600 to −1000 TSS) of the TSS, CG pairs in the promoter, and a downstream (+11311 to +12959) enhancer [9, 57]. Murine sequences are highly (75%) homologous with the human DNA in the 3' enhancer region, however none of the eleven CG pairs in the human gene in this region were present in mice, so no further examination of this region was performed. After our initial report on methylation of the human CD40LG regulatory sequences, a second enhancer approximately 5' of the TSS in humans was reported [58] in a region highly homologous between mice and humans. These sequences may be important regulatory regions for future study.

Demethylation and activation of other genes besides CD40LG on the inactive X chromosome may also contribute to female predominance of lupus. We have previously identified the KIR gene family as methylation-sensitive genes whose inappropriate expression in human CD4+ T cells is associated with SLE [21, 22]. KIR genes constitute a polymorphic family whose products are normally expressed on NK cells, but are aberrantly expressed on T cells by experimental demethylation or in lupus [21]. Expression of KIR2DL4 and KIR3DL1 proteins on T cells contributes to IFN-γ release and macrophage killing in human lupus. While KIR genes are located on autosomal chromosomes in humans, the murine homolog of human KIR3DL1- the KIR-like gene (kirl1) – is located on the X chromosome in mice [59, 60] [39]. Kirl1 mRNA was upregulated in female but not male mice when their ERK signaling was impaired (Fig 2E). Therefore, increased expression of lupus-associated immune genes can contribute to development of the disease and the presence of the genes on the X chromosome would cause overexpression in females alone.

Abnormal X chromosome gene dosage has been linked to autoimmune disease pathogenesis ([61, 62]. Some autoimmune diseases, such as systemic sclerosis, autoimmune thyroid disease and primary biliary cirrhosis are characterized by haploinsufficiency of X chromosome genes particularly in T and B lymphocytes [63, 64]. However, haploinsufficiency was not observed in SLE [65]. Rather, the opposite occurs in that women with Turner's syndrome (45, X0) show increased susceptibility to autoimmune disease, in particular autoimmune thyroiditis but have a strikingly decreased susceptibility to SLE [12]. In contrast, men with Kleinfelter's syndrome possess an extra X chromosome (47, XXY) and have a similar risk as women for developing SLE [12]. Together, these reports support our hypothesis that epigenetic activation of genes on the inactive X chromosome is a major mechanism for female predominance of lupus autoimmunity.

The incidence of many autoimmune diseases including SLE, increases with age [62], while at the same time the percent of methylated genes declines [66]. Early studies showed that patients with SLE and RA exhibit globally hypomethylated DNA ([67]. Javierre et al. [20] recently reported the use of high through-put genome-wide sequencing techniques to study difference in DNA methylation between lupus affected and unaffected monozygous twins. They clearly showed that numerous genes are hypomethylated in SLE affected twins compared to their unaffected twin controls. Our data in mice support a role for environmental factors in lupus development. They further support the role of DNA demethylation as a mechanism in initiating SLE. Unfortunately analysis performed by Javierre et al. [20] did not include any of the genes described in our studies. An earlier study of SLE in monozygous twins by Huang et al. [68] failed to find differential methylation of the androgen receptor gene, located on the X chromosome using methylation-sensitive restriction enzymes. Although the subjects in this study exhibited some of the symptoms associated with lupus, four of the five monozygous affected twins failed to meet the full criteria of SLE diagnosis. Javierre et al. [20] found evidence of differential methylation of the androgen receptor gene between SLE and unaffected monozygous twins but the methylation levels of this gene varied greatly between pairs of twins. Their subjects met the full criteria of SLE but differences in methylation of the gene may reflect differences in disease activity. Another potential source of variability is the cell type studied. Monosomy in X chromosome genes was more frequently observed in T and B lymphocytes than in monocytes and cells of the innate immune system in both systemic sclerosis and autoimmune thyroiditis [64]. The studies by Huang et al. [68] and Javierre et al. [20] used unseparated PBMC. We restricted our investigations to T lymphocytes because they are necessary and sufficient to cause lupus-like disease in mice. None-the-less, we observed heterogeneity in T cell subsets and their expression of methylation-sensitive genes [21, 69]. Together, these observations highlight the importance of factors such as diagnosis, disease activity, the selection of tissue, and heterogeneity of cells in the tissue in understanding the role of genes and their expression in autoimmunity.

In conclusion, our results show that SLE requires a complex interaction between genes, hormones, and the environment. Like human SLE, development of autoimmunity in this model requires 2 X chromosomes, estrogen and reduced ERK signaling induced by environmental agents.

Research Highlights

  1. We examined how genes, environment, and hormones influence female lupus susceptibility.
  2. Environmental agents suppress ERK signaling, epigenetically activating immune genes.
  3. Transgenic female but not male mice with an inducible ERK defect developed lupus.
  4. Suppressing ERK epigenetically activated X chromosome CD40L and Kirl1 genes in females.
  5. Female predisposition required estrogen, two X chromosomes and ERK suppression.

Supplementary Material

Acknowledgments

We are indebted to Dr. Rose Zamoyska for providing the CD2-rtTA mice. We thank Marilyn Jen for excellent technical assistance, and Dr. Roscoe Warner for help in preparing the photomicrographs used in this paper. We also thank Megan Nowland, DVM, DACLAM for helpful discussions on the effects of estrogen administration in mice.

This work was supported by grants AR42525 (BCR), ES015214 (BCR), RO1AG020628 (RY), RO1AG028268 (RY), RO1AR042525 (RY) from the National Institutes of Health, Merit grants from the Dept. of Veterans Affairs (BCR), the Ann Arbor VA GRECC (RY), and funds from the University of Michigan Claude D. Pepper OAIC (NIA P30AG024824) (RY), Nathan Shock Center (NIA AG013283) (RY), and UM-P30 Core Center (NIEHS P30ES017885) (RY).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

[1] S.L.E. Lupus Foundation Website. New York, NY: http://www.lupusny.org/about-lupus/who-gets-lupus.
[2] Pan Y, Sawalha AH. Epigenetic regulation and the pathogenesis of systemic lupus erythematosus. Transl Res. 2009;153:4–10. [PubMed]
[3] Meda FF, Marco;Baccarelli, Andrea; Selmi, Carlo The Epigenetics of Autoimmunity. Cellular & Molecular Immunology. 2011;8:226–36. [PMC free article] [PubMed]
[4] Kelly JA, Moser KL, Harley JB. The genetics of systemic lupus erythematosus: putting the pieces together. Genes Immun. 2002;3(Suppl 1):S71–85. [PubMed]
[5] Castro J, Balada E, Ordi-Ros J, Vilardell-Tarrés M. The complex immunogenetic basis of systemic lupus erythematosus. Autoimmunity Reviews. 2008;7:345–51. [PubMed]
[6] Roubinian JR, Talal N, Greenspan JS, Goodman JR, Siiteri PK. Effect of castration and sex hormone treatment on survival, anti-nucleic acid antibodies, and glomerulonephritis in NZB/NZW F1 mice. J Exp Med. 1978;147:1568–83. [PMC free article] [PubMed]
[7] Cooper GS, Stroehla BC. The epidemiology of autoimmune diseases. Autoimmun Rev. 2003;2:119–25. [PubMed]
[8] Boddaert J, Huong du LT, Amoura Z, Wechsler B, Godeau P, Piette JC. Late-onset systemic lupus erythematosus: a personal series of 47 patients and pooled analysis of 714 cases in the literature. Medicine (Baltimore) 2004;83:348–59. [PubMed]
[9] Lu Q, Wu A, Tesmer L, Ray D, Yousif N, Richardson B. Demethylation of CD40LG on the inactive X in T cells from women with lupus. J Immunol. 2007;179:6352–8. [PubMed]
[10] Zhou Y, Yuan J, Pan Y, Fei Y, Qiu X, Hu N, et al. T cell CD40LG gene expression and the production of IgG by autologous B cells in systemic lupus erythematosus. Clin Immunol. 2009;132:362–70. [PMC free article] [PubMed]
[11] Scofield RH, Bruner GR, Namjou B, Kimberly RP, Ramsey-Goldman R, Petri M, et al. Klinefelter's syndrome (47,XXY) in male systemic lupus erythematosus patients: support for the notion of a gene-dose effect from the X chromosome. Arthritis Rheum. 2008;58:2511–7. [PMC free article] [PubMed]
[12] Sawalha AH, Harley JB, Scofield RH. Autoimmunity and Klinefelter's syndrome: when men have two X chromosomes. J Autoimmun. 2009;33:31–4. [PMC free article] [PubMed]
[13] Heard E. Recent advances in X-chromosome inactivation. Curr Opin Cell Biol. 2004;16:247–55. [PubMed]
[14] Prothero KE, Stahl JM, Carrel L. Dosage compensation and gene expression on the mammalian X chromosome: one plus one does not always equal two. Chromosome Res. 2009;17:637–48. [PubMed]
[15] Kaplan MJ, Lu Q, Wu A, Attwood J, Richardson B. Demethylation of promoter regulatory elements contributes to perforin overexpression in CD4+ lupus T cells. J Immunol. 2004;172:3652–61. [PubMed]
[16] Desai-Mehta A, Lu L, Ramsey-Goldman R, Datta SK. Hyperexpression of CD40 ligand by B and T cells in human lupus and its role in pathogenic autoantibody production. J Clin Invest. 1996;97:2063–73. [PMC free article] [PubMed]
[17] Pau E, Chang N-H, Loh C, Lajoie G, Wither JE. Abrogation of pathogenic IgG autoantibody production in CD40L gene-deleted lupus-prone New Zealand Black mice. Clinical Immunology. 2011;139:215–27. [PubMed]
[18] Higuchi T, Aiba Y, Nomura T, Matsuda J, Mochida K, Suzuki M, et al. Cutting Edge: Ectopic expression of CD40 ligand on B cells induces lupus-like autoimmune disease. J Immunol. 2002;168:9–12. [PubMed]
[19] Hewagama A, Richardson B. The genetics and epigenetics of autoimmune diseases. J Autoimmun. 2009;33:3–11. [PMC free article] [PubMed]
[20] Javierre BM, Fernandez AF, Richter J, Al-Shahrour F, Martin-Subero JI, Rodriguez-Ubreva J, et al. Changes in the pattern of DNA methylation associate with twin discordance in systemic lupus erythematosus. Genome Res. 2010;20:170–9. [PMC free article] [PubMed]
[21] Basu D, Liu Y, Wu A, Yarlagadda S, Gorelik GJ, Kaplan MJ, et al. Stimulatory and inhibitory killer Ig-like receptor molecules are expressed and functional on lupus T cells. J Immunol. 2009;183:3481–7. [PMC free article] [PubMed]
[22] Liu Y, Kuick R, Hanash S, Richardson B. DNA methylation inhibition increases T cell KIR expression through effects on both promoter methylation and transcription factors. Clin Immunol. 2009;130:213–24. [PMC free article] [PubMed]
[23] Lu Q, Kaplan M, Ray D, Zacharek S, Gutsch D, Richardson B. Demethylation of ITGAL (CD11a) regulatory sequences in systemic lupus erythematosus. Arthritis Rheum. 2002;46:1282–91. [PubMed]
[24] Lu Q, Wu A, Richardson BC. Demethylation of the same promoter sequence increases CD70 expression in lupus T cells and T cells treated with lupus-inducing drugs. J Immunol. 2005;174:6212–9. [PubMed]
[25] Oelke K, Lu Q, Richardson D, Wu A, Deng C, Hanash S, et al. Overexpression of CD70 and overstimulation of IgG synthesis by lupus T cells and T cells treated with DNA methylation inhibitors. Arthritis Rheum. 2004;50:1850–60. [PubMed]
[26] Yung RL, Quddus J, Chrisp CE, Johnson KJ, Richardson BC. Mechanism of drug-induced lupus. I. Cloned Th2 cells modified with DNA methylation inhibitors in vitro cause autoimmunity in vivo. J Immunol. 1995;154:3025–35. [PubMed]
[27] Quddus J, Johnson KJ, Gavalchin J, Amento EP, Chrisp CE, Yung RL, et al. Treating activated CD4+ T cells with either of two distinct DNA methyltransferase inhibitors, 5-azacytidine or procainamide, is sufficient to cause a lupus-like disease in syngeneic mice. J Clin Invest. 1993;92:38–53. [PMC free article] [PubMed]
[28] Gorelik G, Fang J-Y, Wu A, Richardson B. Impaired T cell PKC-delta activation decreases ERK pathway signaling in idiopathic and hydralazine-induced lupus. J Immunol. 2007;179:5553–63. [PubMed]
[29] Li Y, Liu Y, Strickland FM, Richardson B. Age-dependent decreases in DNA methyltransferase levels and low transmethylation micronutrient levels synergize to promote overexpression of genes implicated in autoimmunity and acute coronary syndromes. Exp Gerontol. 2010;45:312–22. [PMC free article] [PubMed]
[30] Izui S. Genes and Genetics of Murine Lupus. In: George C, Tsokos CG, Josef S. Smolen, editors. Systemic Lupus Erythematosus: A Companion to Rheumatology Mosby Elsevier. 2007. pp. 171–82.
[31] Sawalha AH, Jeffries M, Webb R, Lu Q, Gorelik G, Ray D, et al. Defective T-cell ERK signaling induces interferon-regulated gene expression and overexpression of methylation-sensitive genes similar to lupus patients. Genes Immun. 2008;9:368–78. [PMC free article] [PubMed]
[32] Walmer DK, Wrona MA, Hughes CL, Nelson KG. Lactoferrin expression in the mouse reproductive tract during the natural estrous cycle: correlation with circulating estradiol and progesterone. Endocrinology. 1992;131:1458–66. [PubMed]
[33] Streng TK, Talo A, Andersson KE, Santti R. A dose-dependent dual effect of oestrogen on voiding in the male mouse? BJU Int. 2005;96:1126–30. [PubMed]
[34] Walker SE, McMurray RW, Besch-Williford CL, Keisler DH. Premature death with bladder outlet obstruction and hyperprolactinemia in New Zealand black X New Zealand white mice treated with ethinyl estradiol and 17 beta-estradiol. Arthritis Rheum. 1992;35:1387–92. [PubMed]
[35] Gakhar G, Wight-Carter M, Andrews G, Olson S, Nguyen TA. Hydronephrosis and urine retention in estrogen-implanted athymic nude mice. Vet Pathol. 2009;46:505–8. [PubMed]
[36] Buhl AE, Yuan YD, Cornette JC, Frielink RD, Knight KA, Ruppel PL, et al. Steroid-induced urogenital tract changes and urine retention in laboratory rodents. J Urol. 1985;134:1262–7. [PubMed]
[37] Game X, Allard J, Escourrou G, Gourdy P, Tack I, Rischmann P, et al. Estradiol increases urethral tone through the local inhibition of neuronal nitric oxide synthase expression. Am J Physiol Regul Integr Comp Physiol. 2008;294:R851–7. [PubMed]
[38] Tsitsikov EN, Ramesh N, Geha RS. Structure of the murine CD40 ligand gene. Mol Immunol. 1994;31:895–900. [PubMed]
[39] Welch AY, Kasahara M, Spain LM. Identification of the mouse killer immunoglobulin-like receptor-like (Kirl) gene family mapping to chromosome X. Immunogenetics. 2003;54:782–90. [PubMed]
[40] Basu D, Gorelik G, Hewagama A, Strickland F, Richardson B. Aberrant KIR Expression Stimulates Interferon- γ Production by Lupus T cells. 2007
[41] Deng C, Yang J, Scott J, Hanash S, Richardson BC. Role of the ras-MAPK signaling pathway in the DNA methyltransferase response to DNA hypomethylation. Biol Chem. 1998;379:1113–20. [PubMed]
[42] MacLeod AR, Rouleau J, Szyf M. Regulation of DNA methylation by the Ras signaling pathway. J Biol Chem. 1995;270:11327–37. [PubMed]
[43] Rouleau J, MacLeod AR, Szyf M. Regulation of the DNA methyltransferase by the Ras-AP-1 signaling pathway. J Biol Chem. 1995;270:1595–601. [PubMed]
[44] Mansilla-Tinoco R, Harland SJ, Ryan PJ, Bernstein RM, Dollery CT, Hughes GR, et al. Hydralazine, antinuclear antibodies, and the lupus syndrome. Br Med J (Clin Res Ed) 1982;284:936–9. [PMC free article] [PubMed]
[45] Singh AK, Yang JQ, Parekh VV, Wei J, Wang CR, Joyce S, et al. The natural killer T cell ligand alpha-galactosylceramide prevents or promotes pristane-induced lupus in mice. Eur J Immunol. 2005;35:1143–54. [PMC free article] [PubMed]
[46] Satoh M, Reeves WH. Induction of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J Exp Med. 1994;180:2341–6. [PMC free article] [PubMed]
[47] Gubbels Bupp MR, Jorgensen TN, Kotzin BL. Identification of candidate genes that influence sex hormone-dependent disease phenotypes in mouse lupus. Genes and immunity. 2008;9:47–56. [PubMed]
[48] Lahita R. Neuroendocrine mechanisms in rheumatic diseases. Rheumatic Disease Clinics of North America. 2000;26:951–68. [PubMed]
[49] Siiteri PK JL, Roubinian J, Talal N. Sex steroids and the immune system - I. Sex differences and autoimmune disease in NZB/NZW F1 hybrid mice. Journal of Steroid Biochemistry. 1980;12:425–32. [PubMed]
[50] Sthoeger ZM, Bentwich Z, Zinger H, Mozes E. The beneficial effect of the estrogen antagonist, tamoxifen, on experimental systemic lupus erythematosus. J Rheumatol. 1994;21:2231–8. [PubMed]
[51] Petri M. Hopkins Lupus Pregnancy Center: 1987 to 1996. Rheum Dis Clin North Am. 1997;23:1–13. [PubMed]
[52] Buyon JP, Petri MA, Kim MY, Kalunian KC, Grossman J, Hahn BH, et al. The effect of combined estrogen and progesterone hormone replacement therapy on disease activity in systemic lupus erythematosus: a randomized trial. Ann Intern Med. 2005;142:953–62. [PubMed]
[53] Huang JL, Yao TC, See LC. Prevalence of pediatric systemic lupus erythematosus and juvenile chronic arthritis in a Chinese population: a nation-wide prospective population-based study in Taiwan. Clin Exp Rheumatol. 2004;22:776–80. [PubMed]
[54] Lockshin MD, Buyon JP. Estrogens and lupus: bubbling cauldron or another overrated Witches' Brew? Arthritis Rheum. 2007;56:1048–50. [PubMed]
[55] Lockshin MD. Sex ratio and rheumatic disease: excerpts from an Institute of Medicine report. Lupus. 2002;11:662–6. [PubMed]
[56] Tsytsykova AV, Tsitsikov EN, Geha RS. The CD40L Promoter Contains Nuclear Factor of Activated T Cells-binding Motifs Which Require AP-1 Binding for Activation of Transcription. Journal of Biological Chemistry. 1996;271:3763–70. [PubMed]
[57] Cron RQ. CD154 transcriptional regulation in primary human CD4 T cells. Immunol Res. 2003;27:185–202. [PubMed]
[58] Brunner M, Zhang M, Genin A, Ho IC, Cron RQ. A T-cell-specific CD154 transcriptional enhancer located just upstream of the promoter. Genes Immun. 2008;9:640–9. [PubMed]
[59] Hoelsbrekken SE, Nylenna O, Saether PC, Slettedal IO, Ryan JC, Fossum S, et al. Cutting edge: molecular cloning of a killer cell Ig-like receptor in the mouse and rat. J Immunol. 2003;170:2259–63. [PubMed]
[60] Wilson EB, Parachoniak CA, Carpenito C, Mager DL, Takei F. Expression of murine killer immunoglobulin-like receptor KIRL1 on CD1d-independent NK1.1(+) T cells. Immunogenetics. 2007;59:641–51. [PubMed]
[61] Invernizzi P. Future directions in genetic for autoimmune diseases. J Autoimmun. 2009;33:1–2. [PubMed]
[62] Invernizzi P, Pasini S, Selmi C, Gershwin ME, Podda M. Female predominance and X chromosome defects in autoimmune diseases. J Autoimmun. 2009;33:12–6. [PubMed]
[63] Invernizzi P, Miozzo M, Battezzati PM, Bianchi I, Grati FR, Simoni G, et al. Frequency of monosomy X in women with primary biliary cirrhosis. Lancet. 2004;363:533–5. [PubMed]
[64] Invernizzi P, Miozzo M, Selmi C, Persani L, Battezzati PM, Zuin M, et al. X chromosome monosomy: a common mechanism for autoimmune diseases. J Immunol. 2005;175:575–8. [PubMed]
[65] Invernizzi P, Miozzo M, Oertelt-Prigione S, Meroni PL, Persani L, Selmi C, et al. X monosomy in female systemic lupus erythematosus. Ann N Y Acad Sci. 2007;1110:84–91. [PubMed]
[66] Fraga MF, Ballestar E, Paz MF, Ropero S, Setien F, Ballestar ML, et al. Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl Acad Sci U S A. 2005;102:10604–9. [PMC free article] [PubMed]
[67] Richardson B, Scheinbart L, Strahler J, Gross L, Hanash S, Johnson M. Evidence for impaired T cell DNA methylation in systemic lupus erythematosus and rheumatoid arthritis. Arthritis Rheum. 1990;33:1665–73. [PubMed]
[68] Huang Q, Parfitt A, Grennan DM, Manolios N. X-chromosome inactivation in monozygotic twins with systemic lupus erythematosus. Autoimmunity. 1997;26:85–93. [PubMed]
[69] Liu Y, Chen Y, Richardson B. Decreased DNA methyltransferase levels contribute to abnormal gene expression in “senescent” CD4(+)CD28(−) T cells. Clin Immunol. 2009;132:257–65. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • MedGen
    MedGen
    Related information in MedGen
  • PubMed
    PubMed
    PubMed citations for these articles

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...