• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of narLink to Publisher's site
Nucleic Acids Res. Oct 10, 1981; 9(19): 5141–5144.
PMCID: PMC327504

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

Abstract

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

Full text

Full text is available as a scanned copy of the original print version. Get a printable copy (PDF file) of the complete article (258K), or click on a page image below to browse page by page. Links to PubMed are also available for Selected References.

Selected References

These references are in PubMed. This may not be the complete list of references from this article.
  • Stanley J, Vassilenko S. A different approach to RNA sequencing. Nature. 1978 Jul 6;274(5666):87–89. [PubMed]
  • Peattie DA. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. [PMC free article] [PubMed]
  • Tanaka Y, Dyer TA, Brownlee GG. An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA. Nucleic Acids Res. 1980 Mar 25;8(6):1259–1272. [PMC free article] [PubMed]
  • Diels L, De Wachter R. An RNA sequencing method based on a two-dimensional combination of gel electrophoresis and thin-layer chromatography [proceedings]. Arch Int Physiol Biochim. 1980 Feb;88(1):B26–B27. [PubMed]
  • Erdmann VA. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1981 Jan 10;9(1):r25–r42. [PMC free article] [PubMed]
  • Hori H, Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. [PMC free article] [PubMed]
  • Küntzel H, Heidrich M, Piechulla B. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences. Nucleic Acids Res. 1981 Mar 25;9(6):1451–1461. [PMC free article] [PubMed]
  • Fox GE, Woese CR. 5S RNA secondary structure. Nature. 1975 Aug 7;256(5517):505–507. [PubMed]
  • Hori H, Osawa S, Iwabuchi M. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res. 1980 Dec 11;8(23):5535–5539. [PMC free article] [PubMed]
  • Luehrsen KR, Fox GE. Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA. Proc Natl Acad Sci U S A. 1981 Apr;78(4):2150–2154. [PMC free article] [PubMed]
  • Zasloff M, Ochoa S. A supernatant factor involved in initiation complex formation with eukaryotic ribosomes. Proc Natl Acad Sci U S A. 1971 Dec;68(12):3059–3063. [PMC free article] [PubMed]
  • Vandenberghe A, Nelles L, De Wachter R. High-pressure liquid chromatography analysis of oligo- and monoribonucleotide mixtures, with special reference to ribosomal RNA constituents. Anal Biochem. 1980 Sep 15;107(2):369–376. [PubMed]
  • Pinck L, Pinck M. Sequence homology at the 3'-ends of alfalfa mosaic virus RNAs. FEBS Lett. 1979 Nov 1;107(1):61–65. [PubMed]
  • Tschudi C, Pirrotta V. Sequence and heterogeneity in the 5S RNA gene cluster of Drosophila melanogaster. Nucleic Acids Res. 1980 Feb 11;8(3):441–451. [PMC free article] [PubMed]
  • Komiya H, Kawakami M, Shimizu N, Takemura S. Nucleotide sequences and evolutional aspect of 5S ribosomal RNAs from Lingula and silkworm. Nucleic Acids Symp Ser. 1980;(8):s119–s122. [PubMed]
  • Benhamou J, Jordan BR. Nucleotide sequence of Drosophila melanogaster 5S RNA: evidence for a general 5S RNA model. FEBS Lett. 1976 Feb 15;62(2):146–149. [PubMed]
  • Benhamou J, Jourdan R, Jordan BR. Sequence of Drosophila 5S RNA synthesized by cultured cells and by the insect at different developmental stages. Homogeneity of the product and homologies with other 5S RNA's at the level of primary and secondary structure. J Mol Evol. 1977 May 13;9(3):279–298. [PubMed]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...